ID: 954649826

View in Genome Browser
Species Human (GRCh38)
Location 3:52154300-52154322
Sequence CAGTCTCCCCGCTGGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954649826_954649838 18 Left 954649826 3:52154300-52154322 CCAGTGTCCCAGCGGGGAGACTG 0: 1
1: 0
2: 0
3: 19
4: 191
Right 954649838 3:52154341-52154363 TCGGCTGGGCTTACCGCGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
954649826_954649835 3 Left 954649826 3:52154300-52154322 CCAGTGTCCCAGCGGGGAGACTG 0: 1
1: 0
2: 0
3: 19
4: 191
Right 954649835 3:52154326-52154348 CCTGGGGAGTTGCTCTCGGCTGG 0: 1
1: 0
2: 5
3: 9
4: 102
954649826_954649839 29 Left 954649826 3:52154300-52154322 CCAGTGTCCCAGCGGGGAGACTG 0: 1
1: 0
2: 0
3: 19
4: 191
Right 954649839 3:52154352-52154374 TACCGCGCAGGGCGCAGCCATGG 0: 1
1: 0
2: 1
3: 8
4: 61
954649826_954649833 -1 Left 954649826 3:52154300-52154322 CCAGTGTCCCAGCGGGGAGACTG 0: 1
1: 0
2: 0
3: 19
4: 191
Right 954649833 3:52154322-52154344 GAGGCCTGGGGAGTTGCTCTCGG 0: 1
1: 0
2: 2
3: 39
4: 288
954649826_954649836 4 Left 954649826 3:52154300-52154322 CCAGTGTCCCAGCGGGGAGACTG 0: 1
1: 0
2: 0
3: 19
4: 191
Right 954649836 3:52154327-52154349 CTGGGGAGTTGCTCTCGGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 129
954649826_954649837 17 Left 954649826 3:52154300-52154322 CCAGTGTCCCAGCGGGGAGACTG 0: 1
1: 0
2: 0
3: 19
4: 191
Right 954649837 3:52154340-52154362 CTCGGCTGGGCTTACCGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954649826 Original CRISPR CAGTCTCCCCGCTGGGACAC TGG (reversed) Intronic
900682360 1:3924026-3924048 CCATCTCCCCTCTGGGACACAGG - Intergenic
900718159 1:4158274-4158296 CAATATCCCTGCTGGGAAACAGG - Intergenic
901055187 1:6445957-6445979 CAGTCCCCCTGCTGGGAGGCAGG - Intronic
901673418 1:10868897-10868919 CATGCACCCCCCTGGGACACAGG - Intergenic
903071798 1:20730454-20730476 CACCCCCACCGCTGGGACACTGG - Intronic
903302355 1:22388556-22388578 CAGTCTCCACGCTGGTAAAATGG - Intergenic
903680425 1:25092853-25092875 CAGTTTCCCCTCTGGGCCAAGGG + Intergenic
903859053 1:26354273-26354295 CTGTCACCCTGCTGGGGCACAGG - Intergenic
904361519 1:29975986-29976008 CACCCTCCACCCTGGGACACAGG + Intergenic
904463380 1:30693515-30693537 CAGACTCCCCTCCGGGACAGTGG + Intergenic
905000311 1:34662976-34662998 CTGTCTTCAAGCTGGGACACTGG + Intergenic
905257995 1:36697519-36697541 CAGTCACCACGAAGGGACACAGG - Intergenic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
906515847 1:46438426-46438448 CAGTTTCCCTCCTGGGACTCAGG - Intergenic
906707961 1:47908732-47908754 CTGCCTCCCAGATGGGACACTGG - Intronic
908865005 1:68537732-68537754 GAGTCTTCCTGCTTGGACACTGG + Intergenic
912410784 1:109479494-109479516 CACTCTCCTGGCTGGGACCCTGG - Exonic
915634728 1:157178192-157178214 CAGTCCCTCTGCTGGGACTCAGG + Intergenic
920872410 1:209805578-209805600 AAGTCCCCTCTCTGGGACACAGG + Intronic
923683769 1:236140613-236140635 CAGTCTCTCCCCTGGCACATTGG - Intergenic
924578206 1:245299984-245300006 CAGTTTCCCTGCTGGAACAATGG - Intronic
1063929957 10:11018460-11018482 CACTCACCCCGCGGGGACCCGGG - Intronic
1064561099 10:16596094-16596116 TGGTCTCCCACCTGGGACACAGG - Intronic
1064863592 10:19854048-19854070 CAGTCTCCCCGGGGGGTCAAGGG - Intronic
1067830490 10:49609053-49609075 CAGTCCGCCCACTGGAACACGGG + Intergenic
1070627893 10:78064063-78064085 CAGATTCTCAGCTGGGACACTGG - Intergenic
1070967850 10:80540462-80540484 CTGCCACCCCGCAGGGACACGGG - Intronic
1073479099 10:103774920-103774942 CAGGCGTCCAGCTGGGACACCGG - Intronic
1075619324 10:123914266-123914288 CATTCTCCCATCTGGGATACCGG + Intronic
1075726402 10:124613016-124613038 CAGGCTCCCCAGTGGGAGACAGG + Intronic
1075728652 10:124623448-124623470 CAGGACCCCCGCTGGGACCCCGG - Exonic
1076369548 10:129942705-129942727 CAGTCACCACGCTGGCAGACAGG - Intronic
1076516431 10:131047520-131047542 CAGTCTCCCAGCAGGCTCACAGG - Intergenic
1076979598 11:197495-197517 CCTTCTCCCCGCTGGGAGTCAGG - Intronic
1077169693 11:1160676-1160698 CAGACTCACCGCTGGGCCCCCGG - Exonic
1077174028 11:1180703-1180725 CAGTCCCGCCTCTGGGACTCAGG - Intronic
1080935656 11:36860459-36860481 GAGTCTCCACACTGGGACATAGG - Intergenic
1081979887 11:47259712-47259734 CAGTTTCCCAGCTAGGACGCTGG + Intronic
1084520811 11:69661570-69661592 CAGTCTCTCCTCTGTGCCACTGG + Intronic
1084944106 11:72629634-72629656 CAGGTTCCCTGCTGGGACACAGG - Intronic
1085442814 11:76579154-76579176 CAGTCTCCCCTTTGGGAGAGAGG + Intergenic
1085522735 11:77147784-77147806 CTGGCTCCCCGCAGGAACACTGG + Exonic
1085600836 11:77854783-77854805 CAGAGTCCCCACTGGGACAGTGG - Intronic
1086774064 11:90807332-90807354 CAGTCTCCCCTCTATCACACAGG - Intergenic
1091154599 11:133361525-133361547 CTGTCTGCGCGCCGGGACACGGG - Intronic
1091588042 12:1827252-1827274 GTGTCTCCCAACTGGGACACAGG - Intronic
1093847186 12:23987358-23987380 TAGTGGCCCCACTGGGACACTGG - Intergenic
1096742140 12:53701759-53701781 CTGGCTCCCCTCTGGGACTCTGG - Intergenic
1097492716 12:60290809-60290831 CAGAGTCCCCACTGGGGCACTGG + Intergenic
1097749648 12:63337642-63337664 CAGGTTCCCCTCTGGGACAATGG + Intergenic
1099956120 12:89353730-89353752 CCGTCTCCCCGCTTGGGCACGGG + Intergenic
1104728770 12:131093843-131093865 CAGTTTCCCCGCTGTGACATGGG + Intronic
1105213757 13:18272808-18272830 CGGACTCCCGGCTGGGACCCAGG - Intergenic
1111239689 13:85457866-85457888 CAGAGCCCCCACTGGGACACTGG + Intergenic
1112443158 13:99439754-99439776 GATTCTCCACTCTGGGACACCGG + Intergenic
1113454848 13:110441055-110441077 CAGTCACCTCGGTGGTACACAGG + Intronic
1113575304 13:111390996-111391018 CAGTTTCCAGGCTGGGGCACTGG + Intergenic
1117648025 14:57872918-57872940 CAGTCTCCTCACTTGGTCACTGG + Intronic
1120140830 14:80927619-80927641 CAGCCTCCCTTCTGGGCCACTGG - Intronic
1120707685 14:87761439-87761461 CAGTGTCCCCACTGGGGCACTGG + Intergenic
1120715660 14:87838418-87838440 CTGTCTTTCCGCTGGGACATGGG - Intronic
1121713361 14:96055369-96055391 CAGTGTCCCCTCTGGGGCAGAGG - Intronic
1122540202 14:102493734-102493756 CAGCCTCCCTGCTGTGACAGGGG + Intronic
1125691703 15:41601170-41601192 CTGTCTCCCCTCTTGGACCCTGG - Intergenic
1125754112 15:42050706-42050728 CAGCCTCCTCTCTGGGACTCAGG + Exonic
1129424598 15:75454596-75454618 CAGTCTCCACGCTCGGAATCGGG - Intronic
1129713231 15:77832181-77832203 GAGGCTGCCAGCTGGGACACAGG + Intergenic
1131515788 15:93075720-93075742 CCGTCTCCCGGCAGGGACACTGG - Intronic
1131515790 15:93075721-93075743 CAGTGTCCCTGCCGGGAGACGGG + Intronic
1134183518 16:12065772-12065794 CAGTCTTCCCACTGGATCACTGG + Intronic
1134916102 16:18072306-18072328 CAGGCTCCACACTGGGACTCTGG + Intergenic
1136109639 16:28056782-28056804 CCATCTCCCTGCTGGGACGCTGG - Intronic
1138578529 16:57924214-57924236 CATTCTCTCTGCTGGGACAGAGG - Intronic
1139635273 16:68254875-68254897 CAGTGTCCCCTCCGGGTCACTGG + Intronic
1141152034 16:81570850-81570872 CAGTCACGCACCTGGGACACAGG - Intronic
1142050030 16:87951846-87951868 CAGTCTCCCCGCCGTGGCTCCGG - Intronic
1142113548 16:88344788-88344810 CGGTCTCGCCTCTGGGACACGGG - Intergenic
1142631565 17:1229365-1229387 GAGTCTCCCCGCGGGGACCCCGG - Intergenic
1142692859 17:1617292-1617314 CAGTCTCCCCACATGGACAGAGG - Intronic
1142814239 17:2412753-2412775 CAGGCCCCCTCCTGGGACACTGG - Intronic
1143001219 17:3796459-3796481 CCGTCTCCCCTCTGGGACATGGG + Intronic
1144403750 17:14932739-14932761 CAGCCTCTGGGCTGGGACACAGG + Intergenic
1144774392 17:17777735-17777757 CAGTTTCCCCACTGGCACAGTGG - Intronic
1145207258 17:20991187-20991209 CAGCCTCCCAGCAGTGACACAGG - Intergenic
1146339348 17:32006687-32006709 CAGGCTCCTAGCTGGGACACTGG + Intergenic
1146951177 17:36907625-36907647 CAGTCCCACCGCTGCGACCCCGG + Intergenic
1147934981 17:44006093-44006115 CCGTCTCCCCGATGGGGCACAGG - Exonic
1148200960 17:45749794-45749816 CAGCAGCCCCGCTAGGACACGGG + Intergenic
1149045096 17:52235998-52236020 CAGTCTTCCCCCTAGGAAACAGG - Intergenic
1151462711 17:74264240-74264262 CAGCCTCCCCGCAGGCTCACTGG + Intergenic
1152073819 17:78146939-78146961 AAGTCCCCCAGCTGGGACCCTGG + Intronic
1154078572 18:11230646-11230668 CTGTCTTCAAGCTGGGACACTGG + Intergenic
1156193483 18:34746628-34746650 TAGTCTCCCCACAGGGACTCTGG + Intronic
1158538988 18:58335479-58335501 CGCTCTCCCAGCTGGGGCACTGG - Exonic
1158591411 18:58782016-58782038 CTGTCTCCCAGCTTCGACACAGG - Intergenic
1159838839 18:73372842-73372864 CAGAGTCCCTACTGGGACACTGG + Intergenic
1161196627 19:2990029-2990051 CAGTTTCCCCACCTGGACACAGG + Intronic
1161653540 19:5499189-5499211 CACTCTCACTGCTGGGCCACTGG - Intergenic
1162153219 19:8659962-8659984 CAGTCTCCCTTCTGTGAAACGGG - Intergenic
1162965352 19:14152928-14152950 CAGTCAGCTGGCTGGGACACTGG + Intronic
1163688106 19:18723771-18723793 CAGTTGCCCTGCAGGGACACTGG + Intronic
1164883997 19:31761424-31761446 CAGTCTCCCGGCTGGGGGAGGGG - Intergenic
1165946467 19:39445800-39445822 CAGTTTCCCCGCTGGTTCCCTGG - Exonic
1168153483 19:54461066-54461088 CAGACTCCCCGGTGGGAAAACGG - Exonic
925376182 2:3387944-3387966 CGGCCTCGCCGCTGGGACTCGGG - Exonic
927135655 2:20094359-20094381 CTGCCTCCCCACTGGGACCCAGG - Intergenic
928951502 2:36817359-36817381 CAGCCTTCCCCCTGGGACTCAGG - Intergenic
931079473 2:58753040-58753062 CAGAGTCCCCACTGGGGCACTGG + Intergenic
932097089 2:68860534-68860556 CAGCCTGCCAGCTGAGACACTGG + Intergenic
932210730 2:69927560-69927582 CAGTCTCCTACCTGGGACCCTGG + Intronic
932397537 2:71458447-71458469 CTGTCTGCCCCCAGGGACACTGG + Intronic
932449041 2:71797948-71797970 GCATCTCCCCGCTGGGACAGAGG - Intergenic
934300570 2:91773941-91773963 CGGACTCCCGGCTGGGACCCGGG + Intergenic
937866401 2:126754472-126754494 CAGCATCCCAGCTGGGACAGAGG + Intergenic
940551880 2:155169319-155169341 CAGCCTCCCTGCTGGCTCACTGG - Intergenic
945095858 2:206218482-206218504 CAGTATCCCTGTTGGGACATGGG - Intergenic
945097362 2:206232055-206232077 CAATCTCCCCACTGTGAGACTGG - Intergenic
948466041 2:238152085-238152107 CAGGCTCCGCCCTGGGACATGGG + Exonic
948894011 2:240919896-240919918 CTGTCTCCACGGTGGGACCCTGG - Intronic
1171006801 20:21474262-21474284 TAGTCACCTAGCTGGGACACTGG - Intergenic
1171193674 20:23180258-23180280 CAGCCTCCCTGCTGGGACATAGG + Intergenic
1175639881 20:60620089-60620111 CAGTCTCCTGGGTGGGACAGAGG - Intergenic
1175639889 20:60620145-60620167 CAGTCTCCCGGGTGGGACAGAGG - Intergenic
1175998927 20:62823547-62823569 AAGCCTCCCTTCTGGGACACAGG - Intronic
1177057704 21:16329106-16329128 ATGTCTCCCAGCTGGGACTCAGG - Intergenic
1178555802 21:33588842-33588864 CAGGGTCACCGCTGGGACAGTGG - Intronic
1179787281 21:43737162-43737184 CAGACTCCCGGCAGGGACACGGG + Intronic
1180074865 21:45457187-45457209 CAGTTTCCCCTCTGTGACTCGGG - Intronic
1180816592 22:18793199-18793221 CGGACTCCCAGCTGGGACCCAGG - Intergenic
1181172951 22:21020418-21020440 GAGCCTCCCCGCTGGGCCAGGGG + Intronic
1181202780 22:21227531-21227553 CGGACTCCCGGCTGGGACCCGGG - Exonic
1181698923 22:24609074-24609096 CGGACTCCCAGCTGGGACCCGGG + Intronic
1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG + Intronic
1183005009 22:34894081-34894103 CAGTCTCTCCCCTGGTACATTGG - Intergenic
1184512919 22:44943524-44943546 CCGTCTCCTCGTGGGGACACGGG + Intronic
1184731538 22:46373602-46373624 CAGGCTCCCCTCTGGGTCCCGGG + Intronic
1185189980 22:49429203-49429225 CAGCTCCCCTGCTGGGACACAGG + Intronic
1203224135 22_KI270731v1_random:67882-67904 CAGACTCCCAGCTGGGACCCAGG + Intergenic
1203266692 22_KI270734v1_random:18910-18932 CGGACTCCCAGCTGGGACCCAGG - Intergenic
950425757 3:12924018-12924040 CATTCTCCCGGCTGGGATATTGG - Intronic
954437094 3:50502214-50502236 CAGTCTCCAGGCCAGGACACTGG + Intronic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
957765712 3:84621677-84621699 CAGAGTCCCCACTGGGGCACTGG - Intergenic
957913970 3:86662115-86662137 CAGTCTCCCTGCAGGTACGCTGG + Intergenic
961608291 3:128114798-128114820 CAGACTCCCCGTGGGGCCACAGG + Intronic
962263057 3:133927214-133927236 CAGCCTCCCCACTGCGTCACTGG - Intergenic
963502578 3:146146714-146146736 CTGATTCCCCGCTGGGACAGAGG + Intronic
966512155 3:180776318-180776340 CAGAGTCCCCACTGGGGCACTGG - Intronic
967035630 3:185646666-185646688 CAGCCTCCCCACTGGGAGCCAGG - Intronic
968608938 4:1548277-1548299 CAGCTTCCCCTCTCGGACACAGG + Intergenic
969043788 4:4321885-4321907 CAGTCTCCCTCCTGGTACAGCGG + Intergenic
969691928 4:8708634-8708656 CACTCTCCCCACTGGGGCTCTGG + Intergenic
970507411 4:16745317-16745339 CAGTCTCCCCGCCTGGGCTCTGG - Intronic
970635501 4:18005473-18005495 CAGTGTCCCAGCAGGGACTCTGG + Intronic
974702728 4:65472396-65472418 CAGTGTCCCCACTGGGGAACTGG - Intronic
980053816 4:128061612-128061634 CCGTCTCTCCGCCGGGACACCGG - Intronic
981144435 4:141308625-141308647 CCTTCTCCCCACTTGGACACAGG - Intergenic
982643789 4:157996571-157996593 CAGTTTCCCCTCTGGGTCAAGGG + Intergenic
982720369 4:158853570-158853592 CAATGTCCCCACTTGGACACAGG - Intronic
983048986 4:163021534-163021556 CAGACTCTCCCCTGGGACACAGG - Intergenic
985262830 4:188130546-188130568 CAGTTGCCCAGCTTGGACACTGG - Intergenic
985650037 5:1103136-1103158 CAGTGTTCAGGCTGGGACACGGG + Intronic
989565984 5:42901848-42901870 GAGTCTCCCCTGTGGGACACTGG + Intergenic
990003943 5:50923562-50923584 CAGCTTCCCCTCTCGGACACAGG - Intergenic
990033225 5:51287539-51287561 CAGTATCCACTTTGGGACACTGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
999286980 5:150399952-150399974 CAGCCTCCCCGCAGGCTCACTGG - Exonic
1001126579 5:169024871-169024893 CAGTATCCCCACAGGGCCACAGG + Intronic
1005092934 6:22078295-22078317 CAGTATCCCTGCTTGGACAGTGG + Intergenic
1006295545 6:33168545-33168567 CATTCTCCCCGGTGGGACCAGGG + Exonic
1006515249 6:34541941-34541963 AGGTCACCCAGCTGGGACACTGG - Intronic
1006604153 6:35244192-35244214 CAGTGTCCCCTCTGGGAAATTGG - Intronic
1006803255 6:36772596-36772618 GAGGCGCCACGCTGGGACACAGG + Intronic
1006804486 6:36779233-36779255 CAGTTTCCCCTCTGGAACATGGG + Intronic
1008485417 6:52030027-52030049 CAGTGGCCACACTGGGACACAGG - Intronic
1012246664 6:96933675-96933697 CAGTATCTCAGCTGGGACAGAGG + Intronic
1015521299 6:134133990-134134012 TAGTATCCCAGCTGGGACAAGGG - Intergenic
1018178890 6:161202999-161203021 GAGTCTCCCCACTGGGAACCAGG + Intronic
1019390788 7:785734-785756 CAGTCTCACTGCTGGCACAGAGG - Exonic
1019484551 7:1283516-1283538 CACTCTCCCTGCTGGGCCCCGGG - Intergenic
1019931313 7:4225172-4225194 CAGTCTCACAACTGGGACATGGG - Intronic
1020237513 7:6367742-6367764 CAGTCTCCCTGCTCCGATACGGG + Intergenic
1021463172 7:20911927-20911949 CAGTGTCCCAGCTGGAAGACAGG + Intergenic
1022286419 7:28958637-28958659 CACTCTGCCCGCGGGGACGCAGG + Intergenic
1026931361 7:74224617-74224639 CTGTCTGCCCGCTGGTCCACAGG + Exonic
1029849396 7:103446276-103446298 CACCCTCCGCGCTGGGACGCCGG + Intergenic
1038017978 8:23530557-23530579 CTAACTCCCCACTGGGACACTGG - Intronic
1041313285 8:56537899-56537921 CCGTCTCTCCTCTGGTACACGGG - Intergenic
1043421196 8:80100757-80100779 CTGTCTTCCAGCTGGGACATTGG - Intronic
1045009573 8:97945880-97945902 CCATCACCCCTCTGGGACACTGG - Intronic
1049220655 8:141427371-141427393 CAGACTCCCTGCTGGGAGAACGG + Intronic
1049583233 8:143422022-143422044 CCGTCTCCTGGCTGGGACCCAGG - Intronic
1053367991 9:37537436-37537458 CATCCTCACCGCTGGGACTCAGG + Exonic
1054190809 9:61984701-61984723 CAGACTCACCGCTATGACACAGG - Intergenic
1056763355 9:89429665-89429687 CTGTCACCCGGCTGGGACCCAGG - Intronic
1057583895 9:96312651-96312673 CTGTCTCCCTGCAGTGACACTGG + Intergenic
1058460054 9:105174295-105174317 CAGGCTCCCAACTGTGACACAGG - Intergenic
1058814578 9:108671398-108671420 GAGTCCCTCCTCTGGGACACTGG - Intergenic
1061011960 9:127961174-127961196 CTGTGTCCCAGCTGTGACACAGG - Intronic
1061678341 9:132230687-132230709 CAGTGTCCCCTCTGGGACTTGGG + Intronic
1061824115 9:133247235-133247257 CAGTCTCCCCACATGGACAATGG - Intergenic
1061959985 9:133983034-133983056 CAGTGGCCGGGCTGGGACACCGG + Intronic
1062042510 9:134410645-134410667 CAGTCTCCACGCCTGGGCACAGG - Intronic
1062364101 9:136200830-136200852 CAGTCTCCCCTCCGGCCCACAGG + Intronic
1190631619 X:52392616-52392638 CCTTCTCCAGGCTGGGACACAGG - Intergenic
1190999597 X:55646200-55646222 CCCTCTCCAGGCTGGGACACAGG - Intergenic
1193665179 X:84307809-84307831 CTGTGTCTCCGCTGGCACACTGG - Intergenic
1194982355 X:100453426-100453448 CAGAGTCCCCACTGGGGCACTGG + Intergenic
1196138852 X:112238988-112239010 CAATCTCCCCACTGGGAAACAGG + Intergenic
1199083741 X:143606112-143606134 CAGAGTCCCCACTGGGGCACTGG + Intergenic
1199671098 X:150148924-150148946 CAGTGTTCCTGCTGGGAAACTGG + Intergenic