ID: 954653982

View in Genome Browser
Species Human (GRCh38)
Location 3:52182685-52182707
Sequence AGGTTGCCCCACCAACATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954653968_954653982 30 Left 954653968 3:52182632-52182654 CCAGGGCAGGCAGGGGTACAAGA No data
Right 954653982 3:52182685-52182707 AGGTTGCCCCACCAACATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954653982 Original CRISPR AGGTTGCCCCACCAACATCT GGG Intergenic
No off target data available for this crispr