ID: 954654432

View in Genome Browser
Species Human (GRCh38)
Location 3:52185440-52185462
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954654425_954654432 8 Left 954654425 3:52185409-52185431 CCGTCCACAGACCAGGCTGAGAT No data
Right 954654432 3:52185440-52185462 GCCTATCCCAGGGTGAGCTTAGG No data
954654422_954654432 18 Left 954654422 3:52185399-52185421 CCTGACCACACCGTCCACAGACC No data
Right 954654432 3:52185440-52185462 GCCTATCCCAGGGTGAGCTTAGG No data
954654424_954654432 13 Left 954654424 3:52185404-52185426 CCACACCGTCCACAGACCAGGCT No data
Right 954654432 3:52185440-52185462 GCCTATCCCAGGGTGAGCTTAGG No data
954654426_954654432 4 Left 954654426 3:52185413-52185435 CCACAGACCAGGCTGAGATCAGA No data
Right 954654432 3:52185440-52185462 GCCTATCCCAGGGTGAGCTTAGG No data
954654429_954654432 -3 Left 954654429 3:52185420-52185442 CCAGGCTGAGATCAGAGGTGGCC No data
Right 954654432 3:52185440-52185462 GCCTATCCCAGGGTGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr