ID: 954655269

View in Genome Browser
Species Human (GRCh38)
Location 3:52190639-52190661
Sequence GTGCTGGACCAGAAGCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655257_954655269 9 Left 954655257 3:52190607-52190629 CCAGCTTCTTCACCCCGCCCCCA No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655266_954655269 -9 Left 954655266 3:52190625-52190647 CCCCACAGGGTGGAGTGCTGGAC No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655262_954655269 -4 Left 954655262 3:52190620-52190642 CCCGCCCCCACAGGGTGGAGTGC No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655267_954655269 -10 Left 954655267 3:52190626-52190648 CCCACAGGGTGGAGTGCTGGACC No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655255_954655269 13 Left 954655255 3:52190603-52190625 CCTCCCAGCTTCTTCACCCCGCC No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655265_954655269 -8 Left 954655265 3:52190624-52190646 CCCCCACAGGGTGGAGTGCTGGA No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655256_954655269 10 Left 954655256 3:52190606-52190628 CCCAGCTTCTTCACCCCGCCCCC No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655251_954655269 26 Left 954655251 3:52190590-52190612 CCCCAGCCTCATTCCTCCCAGCT No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655252_954655269 25 Left 954655252 3:52190591-52190613 CCCAGCCTCATTCCTCCCAGCTT No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655263_954655269 -5 Left 954655263 3:52190621-52190643 CCGCCCCCACAGGGTGGAGTGCT No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655253_954655269 24 Left 954655253 3:52190592-52190614 CCAGCCTCATTCCTCCCAGCTTC No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655261_954655269 -3 Left 954655261 3:52190619-52190641 CCCCGCCCCCACAGGGTGGAGTG No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data
954655254_954655269 20 Left 954655254 3:52190596-52190618 CCTCATTCCTCCCAGCTTCTTCA No data
Right 954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655269 Original CRISPR GTGCTGGACCAGAAGCCAGA AGG Intergenic
No off target data available for this crispr