ID: 954655359

View in Genome Browser
Species Human (GRCh38)
Location 3:52191122-52191144
Sequence GAGCATGGAGGAAGACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655359_954655374 28 Left 954655359 3:52191122-52191144 CCTCCCTGTCTTCCTCCATGCTC No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data
954655359_954655369 14 Left 954655359 3:52191122-52191144 CCTCCCTGTCTTCCTCCATGCTC No data
Right 954655369 3:52191159-52191181 GCTCCCTCTAGCCTTCACTGGGG No data
954655359_954655368 13 Left 954655359 3:52191122-52191144 CCTCCCTGTCTTCCTCCATGCTC No data
Right 954655368 3:52191158-52191180 GGCTCCCTCTAGCCTTCACTGGG No data
954655359_954655364 -8 Left 954655359 3:52191122-52191144 CCTCCCTGTCTTCCTCCATGCTC No data
Right 954655364 3:52191137-52191159 CCATGCTCCTTCTCCATATCAGG No data
954655359_954655367 12 Left 954655359 3:52191122-52191144 CCTCCCTGTCTTCCTCCATGCTC No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data
954655359_954655370 15 Left 954655359 3:52191122-52191144 CCTCCCTGTCTTCCTCCATGCTC No data
Right 954655370 3:52191160-52191182 CTCCCTCTAGCCTTCACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655359 Original CRISPR GAGCATGGAGGAAGACAGGG AGG (reversed) Intergenic
No off target data available for this crispr