ID: 954655361

View in Genome Browser
Species Human (GRCh38)
Location 3:52191126-52191148
Sequence GAAGGAGCATGGAGGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655361_954655369 10 Left 954655361 3:52191126-52191148 CCTGTCTTCCTCCATGCTCCTTC No data
Right 954655369 3:52191159-52191181 GCTCCCTCTAGCCTTCACTGGGG No data
954655361_954655370 11 Left 954655361 3:52191126-52191148 CCTGTCTTCCTCCATGCTCCTTC No data
Right 954655370 3:52191160-52191182 CTCCCTCTAGCCTTCACTGGGGG No data
954655361_954655367 8 Left 954655361 3:52191126-52191148 CCTGTCTTCCTCCATGCTCCTTC No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data
954655361_954655368 9 Left 954655361 3:52191126-52191148 CCTGTCTTCCTCCATGCTCCTTC No data
Right 954655368 3:52191158-52191180 GGCTCCCTCTAGCCTTCACTGGG No data
954655361_954655374 24 Left 954655361 3:52191126-52191148 CCTGTCTTCCTCCATGCTCCTTC No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655361 Original CRISPR GAAGGAGCATGGAGGAAGAC AGG (reversed) Intergenic
No off target data available for this crispr