ID: 954655362

View in Genome Browser
Species Human (GRCh38)
Location 3:52191134-52191156
Sequence GATATGGAGAAGGAGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655362_954655374 16 Left 954655362 3:52191134-52191156 CCTCCATGCTCCTTCTCCATATC No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data
954655362_954655370 3 Left 954655362 3:52191134-52191156 CCTCCATGCTCCTTCTCCATATC No data
Right 954655370 3:52191160-52191182 CTCCCTCTAGCCTTCACTGGGGG No data
954655362_954655367 0 Left 954655362 3:52191134-52191156 CCTCCATGCTCCTTCTCCATATC No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data
954655362_954655368 1 Left 954655362 3:52191134-52191156 CCTCCATGCTCCTTCTCCATATC No data
Right 954655368 3:52191158-52191180 GGCTCCCTCTAGCCTTCACTGGG No data
954655362_954655369 2 Left 954655362 3:52191134-52191156 CCTCCATGCTCCTTCTCCATATC No data
Right 954655369 3:52191159-52191181 GCTCCCTCTAGCCTTCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655362 Original CRISPR GATATGGAGAAGGAGCATGG AGG (reversed) Intergenic
No off target data available for this crispr