ID: 954655363

View in Genome Browser
Species Human (GRCh38)
Location 3:52191137-52191159
Sequence CCTGATATGGAGAAGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655363_954655369 -1 Left 954655363 3:52191137-52191159 CCATGCTCCTTCTCCATATCAGG No data
Right 954655369 3:52191159-52191181 GCTCCCTCTAGCCTTCACTGGGG No data
954655363_954655374 13 Left 954655363 3:52191137-52191159 CCATGCTCCTTCTCCATATCAGG No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data
954655363_954655368 -2 Left 954655363 3:52191137-52191159 CCATGCTCCTTCTCCATATCAGG No data
Right 954655368 3:52191158-52191180 GGCTCCCTCTAGCCTTCACTGGG No data
954655363_954655370 0 Left 954655363 3:52191137-52191159 CCATGCTCCTTCTCCATATCAGG No data
Right 954655370 3:52191160-52191182 CTCCCTCTAGCCTTCACTGGGGG No data
954655363_954655378 28 Left 954655363 3:52191137-52191159 CCATGCTCCTTCTCCATATCAGG No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data
954655363_954655367 -3 Left 954655363 3:52191137-52191159 CCATGCTCCTTCTCCATATCAGG No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655363 Original CRISPR CCTGATATGGAGAAGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr