ID: 954655365

View in Genome Browser
Species Human (GRCh38)
Location 3:52191144-52191166
Sequence GAGGGAGCCTGATATGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655365_954655367 -10 Left 954655365 3:52191144-52191166 CCTTCTCCATATCAGGCTCCCTC No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data
954655365_954655370 -7 Left 954655365 3:52191144-52191166 CCTTCTCCATATCAGGCTCCCTC No data
Right 954655370 3:52191160-52191182 CTCCCTCTAGCCTTCACTGGGGG No data
954655365_954655374 6 Left 954655365 3:52191144-52191166 CCTTCTCCATATCAGGCTCCCTC No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data
954655365_954655378 21 Left 954655365 3:52191144-52191166 CCTTCTCCATATCAGGCTCCCTC No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data
954655365_954655368 -9 Left 954655365 3:52191144-52191166 CCTTCTCCATATCAGGCTCCCTC No data
Right 954655368 3:52191158-52191180 GGCTCCCTCTAGCCTTCACTGGG No data
954655365_954655380 24 Left 954655365 3:52191144-52191166 CCTTCTCCATATCAGGCTCCCTC No data
Right 954655380 3:52191191-52191213 CCTGGTCGCTCTGTCCTAGGTGG No data
954655365_954655369 -8 Left 954655365 3:52191144-52191166 CCTTCTCCATATCAGGCTCCCTC No data
Right 954655369 3:52191159-52191181 GCTCCCTCTAGCCTTCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655365 Original CRISPR GAGGGAGCCTGATATGGAGA AGG (reversed) Intergenic
No off target data available for this crispr