ID: 954655366

View in Genome Browser
Species Human (GRCh38)
Location 3:52191150-52191172
Sequence AGGCTAGAGGGAGCCTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655366_954655380 18 Left 954655366 3:52191150-52191172 CCATATCAGGCTCCCTCTAGCCT No data
Right 954655380 3:52191191-52191213 CCTGGTCGCTCTGTCCTAGGTGG No data
954655366_954655378 15 Left 954655366 3:52191150-52191172 CCATATCAGGCTCCCTCTAGCCT No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data
954655366_954655374 0 Left 954655366 3:52191150-52191172 CCATATCAGGCTCCCTCTAGCCT No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655366 Original CRISPR AGGCTAGAGGGAGCCTGATA TGG (reversed) Intergenic
No off target data available for this crispr