ID: 954655367

View in Genome Browser
Species Human (GRCh38)
Location 3:52191157-52191179
Sequence AGGCTCCCTCTAGCCTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655358_954655367 30 Left 954655358 3:52191104-52191126 CCGTTCTCTTGACTTCAGCCTCC No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data
954655363_954655367 -3 Left 954655363 3:52191137-52191159 CCATGCTCCTTCTCCATATCAGG No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data
954655359_954655367 12 Left 954655359 3:52191122-52191144 CCTCCCTGTCTTCCTCCATGCTC No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data
954655365_954655367 -10 Left 954655365 3:52191144-52191166 CCTTCTCCATATCAGGCTCCCTC No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data
954655361_954655367 8 Left 954655361 3:52191126-52191148 CCTGTCTTCCTCCATGCTCCTTC No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data
954655362_954655367 0 Left 954655362 3:52191134-52191156 CCTCCATGCTCCTTCTCCATATC No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data
954655360_954655367 9 Left 954655360 3:52191125-52191147 CCCTGTCTTCCTCCATGCTCCTT No data
Right 954655367 3:52191157-52191179 AGGCTCCCTCTAGCCTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655367 Original CRISPR AGGCTCCCTCTAGCCTTCAC TGG Intergenic
No off target data available for this crispr