ID: 954655371

View in Genome Browser
Species Human (GRCh38)
Location 3:52191162-52191184
Sequence GGCCCCCAGTGAAGGCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655371_954655383 25 Left 954655371 3:52191162-52191184 CCCTCTAGCCTTCACTGGGGGCC No data
Right 954655383 3:52191210-52191232 GTGGCATCTGCTTGACACCAGGG No data
954655371_954655380 6 Left 954655371 3:52191162-52191184 CCCTCTAGCCTTCACTGGGGGCC No data
Right 954655380 3:52191191-52191213 CCTGGTCGCTCTGTCCTAGGTGG No data
954655371_954655382 24 Left 954655371 3:52191162-52191184 CCCTCTAGCCTTCACTGGGGGCC No data
Right 954655382 3:52191209-52191231 GGTGGCATCTGCTTGACACCAGG No data
954655371_954655378 3 Left 954655371 3:52191162-52191184 CCCTCTAGCCTTCACTGGGGGCC No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655371 Original CRISPR GGCCCCCAGTGAAGGCTAGA GGG (reversed) Intergenic
No off target data available for this crispr