ID: 954655372

View in Genome Browser
Species Human (GRCh38)
Location 3:52191163-52191185
Sequence GGGCCCCCAGTGAAGGCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655372_954655378 2 Left 954655372 3:52191163-52191185 CCTCTAGCCTTCACTGGGGGCCC No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data
954655372_954655380 5 Left 954655372 3:52191163-52191185 CCTCTAGCCTTCACTGGGGGCCC No data
Right 954655380 3:52191191-52191213 CCTGGTCGCTCTGTCCTAGGTGG No data
954655372_954655382 23 Left 954655372 3:52191163-52191185 CCTCTAGCCTTCACTGGGGGCCC No data
Right 954655382 3:52191209-52191231 GGTGGCATCTGCTTGACACCAGG No data
954655372_954655383 24 Left 954655372 3:52191163-52191185 CCTCTAGCCTTCACTGGGGGCCC No data
Right 954655383 3:52191210-52191232 GTGGCATCTGCTTGACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655372 Original CRISPR GGGCCCCCAGTGAAGGCTAG AGG (reversed) Intergenic
No off target data available for this crispr