ID: 954655373

View in Genome Browser
Species Human (GRCh38)
Location 3:52191170-52191192
Sequence GGCTGAGGGGCCCCCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655373_954655378 -5 Left 954655373 3:52191170-52191192 CCTTCACTGGGGGCCCCTCAGCC No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data
954655373_954655380 -2 Left 954655373 3:52191170-52191192 CCTTCACTGGGGGCCCCTCAGCC No data
Right 954655380 3:52191191-52191213 CCTGGTCGCTCTGTCCTAGGTGG No data
954655373_954655384 30 Left 954655373 3:52191170-52191192 CCTTCACTGGGGGCCCCTCAGCC No data
Right 954655384 3:52191223-52191245 GACACCAGGGTGCAGCCCTGAGG No data
954655373_954655382 16 Left 954655373 3:52191170-52191192 CCTTCACTGGGGGCCCCTCAGCC No data
Right 954655382 3:52191209-52191231 GGTGGCATCTGCTTGACACCAGG No data
954655373_954655383 17 Left 954655373 3:52191170-52191192 CCTTCACTGGGGGCCCCTCAGCC No data
Right 954655383 3:52191210-52191232 GTGGCATCTGCTTGACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655373 Original CRISPR GGCTGAGGGGCCCCCAGTGA AGG (reversed) Intergenic