ID: 954655374

View in Genome Browser
Species Human (GRCh38)
Location 3:52191173-52191195
Sequence TCACTGGGGGCCCCTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655361_954655374 24 Left 954655361 3:52191126-52191148 CCTGTCTTCCTCCATGCTCCTTC No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data
954655359_954655374 28 Left 954655359 3:52191122-52191144 CCTCCCTGTCTTCCTCCATGCTC No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data
954655362_954655374 16 Left 954655362 3:52191134-52191156 CCTCCATGCTCCTTCTCCATATC No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data
954655363_954655374 13 Left 954655363 3:52191137-52191159 CCATGCTCCTTCTCCATATCAGG No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data
954655365_954655374 6 Left 954655365 3:52191144-52191166 CCTTCTCCATATCAGGCTCCCTC No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data
954655366_954655374 0 Left 954655366 3:52191150-52191172 CCATATCAGGCTCCCTCTAGCCT No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data
954655360_954655374 25 Left 954655360 3:52191125-52191147 CCCTGTCTTCCTCCATGCTCCTT No data
Right 954655374 3:52191173-52191195 TCACTGGGGGCCCCTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655374 Original CRISPR TCACTGGGGGCCCCTCAGCC TGG Intergenic
No off target data available for this crispr