ID: 954655378

View in Genome Browser
Species Human (GRCh38)
Location 3:52191188-52191210
Sequence CAGCCTGGTCGCTCTGTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954655365_954655378 21 Left 954655365 3:52191144-52191166 CCTTCTCCATATCAGGCTCCCTC No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data
954655373_954655378 -5 Left 954655373 3:52191170-52191192 CCTTCACTGGGGGCCCCTCAGCC No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data
954655371_954655378 3 Left 954655371 3:52191162-52191184 CCCTCTAGCCTTCACTGGGGGCC No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data
954655372_954655378 2 Left 954655372 3:52191163-52191185 CCTCTAGCCTTCACTGGGGGCCC No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data
954655363_954655378 28 Left 954655363 3:52191137-52191159 CCATGCTCCTTCTCCATATCAGG No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data
954655366_954655378 15 Left 954655366 3:52191150-52191172 CCATATCAGGCTCCCTCTAGCCT No data
Right 954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954655378 Original CRISPR CAGCCTGGTCGCTCTGTCCT AGG Intergenic
No off target data available for this crispr