ID: 954656774

View in Genome Browser
Species Human (GRCh38)
Location 3:52198631-52198653
Sequence AAATGAGGGTAGGGGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954656774_954656787 22 Left 954656774 3:52198631-52198653 CCCTCATACCCCTACCCTCATTT 0: 1
1: 0
2: 0
3: 26
4: 298
Right 954656787 3:52198676-52198698 GCCCAGTTCTTCCCGCTGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 142
954656774_954656785 20 Left 954656774 3:52198631-52198653 CCCTCATACCCCTACCCTCATTT 0: 1
1: 0
2: 0
3: 26
4: 298
Right 954656785 3:52198674-52198696 ATGCCCAGTTCTTCCCGCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 111
954656774_954656786 21 Left 954656774 3:52198631-52198653 CCCTCATACCCCTACCCTCATTT 0: 1
1: 0
2: 0
3: 26
4: 298
Right 954656786 3:52198675-52198697 TGCCCAGTTCTTCCCGCTGTGGG 0: 1
1: 0
2: 1
3: 26
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954656774 Original CRISPR AAATGAGGGTAGGGGTATGA GGG (reversed) Intronic
903287097 1:22284163-22284185 AAATTAAGGTTGGGGTAAGAGGG + Intergenic
903926292 1:26833241-26833263 AAAGGAGGGAAGGAGGATGAAGG + Intronic
905770593 1:40635761-40635783 TGTTGAGGGGAGGGGTATGAAGG + Intronic
905892859 1:41528108-41528130 AGGTGAGGGTAAGGGTGTGAGGG - Intronic
907819691 1:57954832-57954854 AAATGAGGTAATGGGTGTGAAGG - Intronic
908469899 1:64433495-64433517 AAATGAAGGGAGGAGTAAGATGG - Intergenic
908484671 1:64578878-64578900 AAATCTGGGTAGGCTTATGATGG - Intronic
908631170 1:66109389-66109411 AGATGAGGATGGGGGAATGAAGG + Intronic
909582955 1:77258702-77258724 AAATGGGGGAGGGGGTATGGTGG + Intergenic
909893602 1:81037706-81037728 AAATGGGATTAGGAGTATGAGGG - Intergenic
910504658 1:87936083-87936105 AAATGAGTGTAGGGGTGCCAAGG + Intergenic
910536136 1:88300009-88300031 AAATGAGGGTAAAGAAATGAGGG + Intergenic
912250972 1:108012145-108012167 AAAGGATGGGAGGGGGATGAGGG + Intergenic
914900449 1:151708685-151708707 AAATGAGGGTAGGGGGATATGGG + Intronic
915206352 1:154273099-154273121 AACTGGGGGAAGGTGTATGAAGG + Intronic
915336307 1:155144362-155144384 AAATGTGGCTAGGGCTTTGAAGG - Intergenic
916572189 1:166037680-166037702 AAAGGAAGGTTGGGGTAAGAAGG - Intergenic
917034308 1:170730178-170730200 AAATGAGGGGAGGAGAAGGATGG - Intronic
917117254 1:171615034-171615056 AAATCAGGGTGGGGGGAAGAAGG + Intergenic
917163631 1:172086534-172086556 AAATGTGGGTAGTGCAATGAAGG + Intronic
917907460 1:179601416-179601438 ACATGAGGGGAAGGGTAGGAAGG - Intronic
921436467 1:215129302-215129324 AAATGGGGGTAGGGGGAGAAGGG - Intronic
922220772 1:223556928-223556950 AACTGAGGCGAGGGGTAGGAGGG + Intronic
922410185 1:225365788-225365810 TACTGGGGGTAGGGGAATGAAGG + Intronic
922589562 1:226764310-226764332 TAATGAGGGTAAGGGCAGGATGG + Intergenic
924617458 1:245624402-245624424 AAATGCTGGTGGGGGTATGGAGG - Intronic
924772282 1:247088500-247088522 ATGTGAGGGATGGGGTATGAGGG + Intergenic
1063505876 10:6599186-6599208 AAAAGAGGGTAGGGAGCTGAGGG - Intergenic
1064283741 10:13973689-13973711 AAGTGAGGGGAGGGGAAGGAAGG + Intronic
1065585321 10:27211954-27211976 AAGTGGGGGTGGGGGTAGGAAGG + Intronic
1067196935 10:44128475-44128497 AAAGTAGGGGAGGGGGATGATGG - Intergenic
1067296311 10:44976989-44977011 AACTGGTGGTAGGGGTGTGAGGG - Exonic
1068030197 10:51697506-51697528 AATTGAGGGTGGGGGGAGGAGGG - Exonic
1069101328 10:64324663-64324685 AAATGGGGGTAGGGGCAGGTGGG + Intergenic
1070165311 10:73893267-73893289 AAATGATGCTAGGTGGATGACGG + Intergenic
1071480626 10:86062301-86062323 AGATGAGGGTGAGGGTATGATGG + Intronic
1071715876 10:88094840-88094862 AAATGTGGGGTGGGGTAGGAGGG - Intergenic
1072032128 10:91530922-91530944 AAATGAGGGTGAGGGTTTCAGGG + Intergenic
1072560801 10:96571862-96571884 AAATGGGGGAAGGGGAAGGACGG + Intronic
1072831461 10:98663071-98663093 ACATAAGGGCAGGGGTATGAGGG + Intronic
1075560698 10:123466462-123466484 AATTGGGGGTCGGGGTGTGATGG - Intergenic
1076508763 10:130997699-130997721 AAATATGGGAAGGGGTGTGAGGG + Intergenic
1077208765 11:1358334-1358356 ACATGAGGGTGGGGGTGTGCAGG + Intergenic
1077732105 11:4742433-4742455 GCATGAGGGGAGGGGTATGATGG + Intronic
1078396698 11:10987762-10987784 AAATGAGGCCAGAGGGATGAAGG - Intergenic
1079751830 11:24209478-24209500 AAGTGAGGGTAGGGGCTTGGAGG + Intergenic
1080931314 11:36814353-36814375 GAAGGAGGGAAGGGGAATGAAGG - Intergenic
1081133293 11:39406829-39406851 AATTTATGGTAGGGGTATGGTGG + Intergenic
1084196097 11:67524188-67524210 TAATGCGGGCAGGGGTATGAGGG - Intergenic
1085670874 11:78463847-78463869 TAGTGAGGGGAGGGCTATGAAGG - Intronic
1087116288 11:94528567-94528589 AAATGAGGAAAGGGAAATGAGGG + Intergenic
1087990348 11:104741096-104741118 AAATGCAGGTAGAGATATGAAGG + Intergenic
1089484927 11:118837910-118837932 AACTGTGAGAAGGGGTATGAAGG + Intergenic
1090153010 11:124404942-124404964 AAAAGTGTGTGGGGGTATGAAGG + Intergenic
1090975194 11:131673943-131673965 GAAAGAGGGTAGGGAGATGATGG + Intronic
1092248446 12:6877193-6877215 AATTGAGGGCAGGGGCAGGAGGG + Intronic
1092255952 12:6927121-6927143 AATTGGGGGTGGGGGGATGAAGG - Intronic
1092929478 12:13301752-13301774 AAAGGGTGGGAGGGGTATGAGGG + Intergenic
1095299032 12:40560711-40560733 ATATGTGGGGAGGGGTATGGTGG + Intronic
1095531496 12:43191734-43191756 AAATGGGGGTAGGGATGTGTAGG - Intergenic
1095777677 12:46027037-46027059 AATTGAGGGAAGGGGTGTTATGG + Intergenic
1096020068 12:48316622-48316644 AAATTATGGTAGGGGAAGGATGG + Intergenic
1096548401 12:52356641-52356663 AAGCGAGGGTGGGGGTAGGAGGG + Intergenic
1096644182 12:53020034-53020056 AAATAAGAGTGGGGATATGAGGG + Intronic
1096859794 12:54517004-54517026 AAATGTTGGGAGGGGAATGATGG + Intronic
1098430094 12:70409610-70409632 AAAGTAGGGTAGTGCTATGAAGG + Intronic
1099177981 12:79443839-79443861 AGATGAGAGTAGAGGTATGCTGG - Intronic
1099343634 12:81470902-81470924 AGATGGGGGAAGGGGTATGTGGG - Intronic
1100741868 12:97602732-97602754 AATTGGGGGTAAGGGGATGAGGG + Intergenic
1101158010 12:101945946-101945968 AAAAGAGGGCAGAGGAATGAGGG - Intronic
1101879567 12:108617095-108617117 AAATGGGGGGCGGGGGATGATGG - Intergenic
1103243772 12:119437511-119437533 AATTGAGGCTTGGAGTATGAGGG + Intronic
1105685231 13:22774534-22774556 AAATTATTTTAGGGGTATGAAGG - Intergenic
1107752200 13:43579966-43579988 CAAGGAGGGTAGGGGTAGGGTGG + Intronic
1108624974 13:52218883-52218905 ACATGGGGGTTGGGGTAAGAAGG - Intergenic
1108661078 13:52587534-52587556 ACATGGGGGTTGGGGTAAGAAGG + Intergenic
1108697569 13:52916132-52916154 AAATGAGGGTTGGGACAGGATGG - Intergenic
1108856781 13:54802505-54802527 AAATGAGGGTTGGGGTAGGGAGG + Intergenic
1109967011 13:69713757-69713779 AAATAATGGTAGTGGTATAATGG + Intronic
1110298878 13:73901848-73901870 AATTGAGGGTAGGGATCTAAGGG + Intronic
1110680381 13:78304337-78304359 AAATGAGGAAAAGGATATGAAGG + Intergenic
1111975173 13:94959117-94959139 AAATGGGGGTAGTGGCCTGAAGG + Intergenic
1112714971 13:102173811-102173833 AGCTGAGGGTAGGGGTAGGGGGG + Intronic
1113039511 13:106089551-106089573 AAAGGAGGGAAGGGGTTTGCTGG + Intergenic
1114945115 14:27671742-27671764 AAATAGGGGAATGGGTATGATGG - Intergenic
1115084623 14:29498819-29498841 GAAGGAGGGTAGGGGGTTGAAGG + Intergenic
1118451540 14:65907035-65907057 AAAGGAGGGTAAGGGAAGGAGGG + Intergenic
1119289466 14:73483505-73483527 AATTGAGGGTTGGGGCATGATGG - Intronic
1119910787 14:78347518-78347540 GAATATGGGTAGGGGAATGAAGG - Intronic
1120325312 14:83016803-83016825 AAATGTTGGGAGGGGTGTGAGGG + Intergenic
1122977854 14:105178351-105178373 AACTGGGGGTAGGGGTGTGTGGG - Intronic
1123952911 15:25300638-25300660 AAATGACAGTAGGAGTATAAAGG + Intergenic
1126385938 15:48093472-48093494 AGATGAGGGAAGGGGGAGGAAGG - Intergenic
1128082909 15:64866870-64866892 AAATGCTGATAGGGGTATGTTGG + Exonic
1128083774 15:64872300-64872322 ACATGAGGGTAGGGGTGGGGAGG - Intronic
1128227156 15:66009913-66009935 AAAGGTGGGTAGGGGGAAGAAGG + Intronic
1128350126 15:66882845-66882867 AAATGAGGGAACGGTTAAGAAGG - Intergenic
1130010740 15:80151837-80151859 AAAGGAGGGGAGGGGGATAAAGG - Intergenic
1130763872 15:86850567-86850589 AAATGAGGGTGGGAGGAAGATGG - Intronic
1130909019 15:88258214-88258236 AGATGGGGGAAGGGGTATGCCGG + Intergenic
1131078199 15:89512356-89512378 GAATTAGGATAGGGGTATGTTGG - Intergenic
1133936087 16:10270525-10270547 AAAGGAGGGTAGGGATATCCTGG - Intergenic
1134566522 16:15256700-15256722 AAGTGAGGGAAGGAGGATGATGG - Intergenic
1134735974 16:16499999-16500021 AAGTGAGGGAAGGAGGATGATGG + Intergenic
1134931550 16:18212160-18212182 AAGTGAGGGAAGGAGGATGATGG - Intergenic
1135538520 16:23312577-23312599 GGATGAGGGTAGGGCCATGATGG + Intronic
1135860379 16:26050746-26050768 AAATGAGCGGAGGTGTATGAAGG + Intronic
1137288591 16:47036719-47036741 AAATGGGGCTAGGGGAATGAGGG - Intergenic
1137594814 16:49716464-49716486 AAATGACGTCATGGGTATGAGGG - Intronic
1137859113 16:51828517-51828539 AATTGAGTGTGGGGGTAGGAAGG - Intergenic
1139063234 16:63281173-63281195 AATTGAGGGAAAGGGTAGGAGGG + Intergenic
1139137102 16:64217822-64217844 AAGAGAGGACAGGGGTATGAGGG - Intergenic
1140183933 16:72749578-72749600 AAATGAGGTTAGGTTTTTGAGGG + Intergenic
1141841554 16:86577154-86577176 AGATGAGGGAAGGGGGAGGATGG - Intronic
1142552662 17:750742-750764 AAATGGTGGGAGGGGTAAGATGG - Intronic
1143238266 17:5421559-5421581 AAATGGGGTTAGGGGAATGGTGG - Intronic
1143697444 17:8630774-8630796 CAATGAGGGTAGGGGTGGGTGGG - Intergenic
1144020393 17:11235906-11235928 AATGGTGGGTAGTGGTATGATGG + Intergenic
1144367571 17:14559405-14559427 AAATGAGGGTAGGGGTGGTCAGG - Intergenic
1144487635 17:15680563-15680585 AAAGGATGGTAGGGGCAGGATGG - Intronic
1145833427 17:27935928-27935950 AAATGTAGGTAAGTGTATGAAGG - Intergenic
1147027028 17:37595566-37595588 TGCTGAGGGTTGGGGTATGATGG - Intronic
1147301660 17:39533713-39533735 AAATGGGGGTGGGGGTGAGATGG - Exonic
1147927853 17:43956274-43956296 ATTGGAGGGTGGGGGTATGAGGG - Intronic
1148516397 17:48222325-48222347 GAAAGAGTGTAGGAGTATGAAGG - Intronic
1151062152 17:71107765-71107787 GAATGGGGGTAGGGGTGAGAAGG + Intergenic
1151198765 17:72452411-72452433 AAACGAGGACAGGGGTATGCTGG + Intergenic
1153056811 18:953748-953770 AAATAAGTGTTGGGGGATGAGGG + Intergenic
1153163000 18:2229726-2229748 AAAGGATGGGAGGGGGATGAGGG + Intergenic
1154502891 18:15005342-15005364 AGATGAGGGAAGGGCTTTGACGG - Intergenic
1155111965 18:22724691-22724713 CACTGAGGTTTGGGGTATGAAGG - Intergenic
1155671471 18:28377034-28377056 AAAGAATGGTAGGGCTATGATGG - Intergenic
1156380982 18:36560966-36560988 TCATGAGGGTTGGGGTATGGGGG - Intronic
1156887098 18:42148113-42148135 AACTGAGGTCTGGGGTATGAAGG - Intergenic
1157293447 18:46425679-46425701 AGATGAGGGGAGTGGAATGAGGG - Intronic
1157964156 18:52189325-52189347 AAAGGAGGATGGGGGTATAAGGG + Intergenic
1158372190 18:56820624-56820646 AACTGAGGGCAGGGGGAGGAGGG - Intronic
1159885942 18:73906989-73907011 AAATGAGGGTTGGTGGATGATGG - Intergenic
1161095444 19:2387764-2387786 AAATCAGGGGTGGGGTGTGAAGG + Intergenic
1161636706 19:5393723-5393745 AGATGTGGCTGGGGGTATGAAGG + Intergenic
1164369417 19:27630270-27630292 AAATCAGGGAAGGGATATGTGGG + Intergenic
1164581812 19:29439345-29439367 AAAAGAGGGGAGGGGGGTGATGG + Intergenic
1166459010 19:42969541-42969563 AGATGAGAGCAGGGGTAAGAAGG + Intronic
1166475953 19:43124817-43124839 AGATGAGAGCAGGGGTAAGAAGG + Intronic
925483868 2:4305988-4306010 AAAGGGTGGGAGGGGTATGAGGG + Intergenic
927446990 2:23171808-23171830 GTATGAGGGTGGGAGTATGAGGG - Intergenic
928291870 2:30046278-30046300 AAATGGGGAAAGGGGTCTGAGGG - Intergenic
930834563 2:55779448-55779470 AAACAAGGGTAGAGGTATGTGGG - Intergenic
932226484 2:70045156-70045178 AAAGGAGGGTAGGAGAAAGAAGG - Intergenic
932296778 2:70630893-70630915 AAAGGAGGGCAGGGGTAAGAAGG + Intronic
932638429 2:73414966-73414988 AAATGTGTATAGGGGTATGGGGG - Intronic
933560211 2:83877955-83877977 AAATGAGAATGGGGGTAAGACGG + Intergenic
935080267 2:99786148-99786170 AAAGGATGGTAGGGAGATGAAGG + Intronic
938551961 2:132390886-132390908 AAATGAGGAGTGGGGGATGATGG - Intergenic
939366640 2:141241610-141241632 AAATGAGGGTACTGGGATGTTGG - Intronic
940893216 2:159055427-159055449 AACTGAGGGTAGGGGGAATAGGG - Intronic
941112775 2:161434725-161434747 ACTTGAGGGTAGGGGTTAGAAGG - Intronic
941125817 2:161581768-161581790 AAATGACTGTAAGGGGATGAAGG - Intronic
942117011 2:172737856-172737878 AAATGAGGATAGGACTATCAGGG + Intronic
942219369 2:173754540-173754562 AAATGGGGGGAGGGGAGTGAAGG + Intergenic
942572375 2:177327286-177327308 ATATAAAGGTAGGAGTATGAAGG + Intronic
943711789 2:191105154-191105176 AAAGGAGGGTAGTGGTACAAGGG - Intronic
946217323 2:218194704-218194726 AATTGAGGGTGGGGGCATCAGGG - Intergenic
946544419 2:220722035-220722057 AAATGGTGGGAGAGGTATGAGGG - Intergenic
947796395 2:232896586-232896608 GGGTGAGGGTAGGGGTGTGAGGG + Intronic
947948030 2:234123307-234123329 AAATTAGGGTAGGGTTCAGAGGG - Intergenic
1170072879 20:12387917-12387939 AAATGAGGTCAGTGGTATGTTGG + Intergenic
1170180662 20:13526143-13526165 AAATAAGGGTAGGGGACTGGTGG + Intronic
1170840963 20:19924307-19924329 GTATGAAGGTGGGGGTATGAAGG - Intronic
1170841003 20:19924465-19924487 GTATGAAGGTGGGGGTATGAAGG - Intronic
1170841031 20:19924561-19924583 GAATGAAGGTGGGGGTATGAAGG - Intronic
1171321452 20:24248040-24248062 AAAGGAGGGCAGGGGAAGGAGGG - Intergenic
1171721694 20:28569820-28569842 AAATGAGGGAAAGGGAAGGAAGG - Intergenic
1172841493 20:37904914-37904936 AAATGAGGTGAGGGGCATGAAGG - Intronic
1174620445 20:51870265-51870287 TAAGGAGGGTAGGGGTAGTAGGG + Intergenic
1175625861 20:60487714-60487736 CAGTGAGGGTAGGTGTATTAGGG + Intergenic
1176217240 20:63954018-63954040 AAATGAGGCTGGGGGGAGGAGGG + Intronic
1176951972 21:15058661-15058683 AAATGAGAGTAGTAGTATAATGG - Intronic
1177885119 21:26737524-26737546 AAATGTGGGTGGGGGTACCAAGG - Intergenic
1177906862 21:26982232-26982254 AAAAGAGGGGAGAGTTATGAGGG + Intergenic
1180237575 21:46472962-46472984 AAATGTGGGTAGTGGGACGAGGG + Intronic
1180295249 22:10928507-10928529 AAATGAGGGAAAGGGAAGGAAGG - Intergenic
1181910361 22:26233778-26233800 TAATGAGTGTTGGGGTATGGGGG + Intronic
950364374 3:12472649-12472671 AAATGAGGCAAGGTGTGTGAAGG - Intergenic
950635547 3:14311790-14311812 AAGAGAGGGTGGGGGTAGGAAGG - Intergenic
951049649 3:18079880-18079902 AATTGGGGGTAGGAGTTTGAAGG + Intronic
951136827 3:19113592-19113614 AAAAGAAGGTAAGGGGATGAAGG - Intergenic
951221691 3:20075569-20075591 AAACCAAGGAAGGGGTATGATGG - Intronic
951614512 3:24526226-24526248 AAAGGAAGGAAGGGGTATCAGGG + Intergenic
952367374 3:32686638-32686660 AAATGAGGAAAGGTGGATGAGGG + Intronic
952490458 3:33866472-33866494 GGCTGAGGGAAGGGGTATGAAGG - Exonic
952512428 3:34070788-34070810 AACTGAAGGTGGGGGTGTGAAGG - Intergenic
952919337 3:38274476-38274498 ATTTGAGGGTAGGGGGAAGAGGG - Intronic
954412481 3:50376868-50376890 AAACCAGGGTAGGGGCAAGATGG - Intronic
954454083 3:50587660-50587682 ACATGCGGGTAGGGATATGTAGG + Intergenic
954656774 3:52198631-52198653 AAATGAGGGTAGGGGTATGAGGG - Intronic
955037788 3:55285752-55285774 AAATGATGGAAGGGGTAGCATGG - Intergenic
955467947 3:59255844-59255866 AAATGTGGTTAGGGCTTTGAAGG + Intergenic
956610863 3:71121493-71121515 TAATGGGAGTAGGAGTATGATGG - Intronic
956751030 3:72344070-72344092 AAATGTGGGTAGGTGTATGGGGG - Intergenic
956893098 3:73631837-73631859 AAATGAAGGTAAGGGAATGAGGG + Intergenic
957295087 3:78325073-78325095 AAAGGAGGGAAGGGGTTTGGGGG - Intergenic
957853828 3:85846950-85846972 AAATGAGTGTAGGATTAAGATGG + Intronic
958271801 3:91509022-91509044 AAAAAAGGATAGTGGTATGACGG - Intergenic
959204513 3:103288144-103288166 ATCTGAGGGGAGGGGTAAGAGGG - Intergenic
959976847 3:112470649-112470671 AAATGTGGGTTTGGCTATGATGG - Intronic
960432032 3:117581079-117581101 AAATGGGGGTGGGGGAAGGAGGG - Intergenic
960786905 3:121383466-121383488 AAATGACAGAAGGGGTATGTGGG + Intronic
962878369 3:139553341-139553363 AAAGAAGGGTAGGGGGATGATGG - Intergenic
964198396 3:154090145-154090167 AATTTAGGGCAGGGGTGTGAGGG - Intergenic
964418606 3:156476991-156477013 AATTAAAGGTAGGGGTAAGATGG - Intronic
964949413 3:162269753-162269775 AAATGAAGGTAGGAGGAAGAGGG + Intergenic
965457561 3:168922609-168922631 AATTTTGGGTAGGGGTTTGAGGG - Intergenic
966548769 3:181181765-181181787 AAGGGAGGGTAGAGGAATGAAGG - Intergenic
967206525 3:187127657-187127679 AAATGAAGGTGGTGGGATGATGG - Intronic
967264889 3:187681845-187681867 AAATGAGGATTAGGGTCTGAAGG - Intergenic
968676402 4:1883306-1883328 AAATGGGGGGAGGGGTATCAAGG - Intronic
969975858 4:11100674-11100696 AAATGAGGTATGGGGTAAGATGG + Intergenic
971484087 4:27141685-27141707 AAAGGAGGGTGGGGGTGGGATGG + Intergenic
971541728 4:27826547-27826569 AGATGAGGGTGGGTGTAAGAGGG - Intergenic
972576568 4:40357394-40357416 AAATGAGGGTAAGGATTAGAAGG + Intergenic
972647041 4:40978678-40978700 AACTGAGGATAGGGATAGGAAGG - Intronic
973184478 4:47309277-47309299 AAATCAGAGTAGGGGATTGAGGG - Intronic
976191115 4:82488078-82488100 AAAGGATGGGAGGGGGATGAGGG - Intronic
976259465 4:83131805-83131827 AAATGAGGGTAAGAGAAGGAAGG - Intronic
976380689 4:84394912-84394934 AAATGAGGCTGGGGCAATGAGGG + Intergenic
977171391 4:93767125-93767147 AAATGAGAGAAGGGGAATGAAGG + Intronic
979806218 4:124974912-124974934 AAATGAGGTAATGGGTGTGAAGG - Intergenic
980953962 4:139409428-139409450 AAATGGGGGAAGGGGGCTGAAGG + Intronic
981375612 4:144011761-144011783 AAATGAGTGTATGGGAATGTGGG - Intronic
981386225 4:144133949-144133971 AAATGAGTGTATGGGAATGTGGG - Intronic
982874926 4:160635407-160635429 AAATAGGGGTGGGGGTAGGAGGG - Intergenic
984885241 4:184443970-184443992 GAATAAGGGTAGGCCTATGAAGG - Intronic
986081521 5:4399365-4399387 GAATGAGGGTGGGGGTGTGAAGG + Intergenic
986172668 5:5326780-5326802 AAGTGAGGGGAGGGGCAGGAGGG - Intergenic
986503988 5:8430182-8430204 AAATGGGGGTGGGGGAATGGCGG + Intergenic
986537710 5:8808862-8808884 AAAGAAGGGTGGGGGTGTGAGGG - Intergenic
986992060 5:13565651-13565673 AGATGAGTGTTGGGGTTTGATGG - Intergenic
987113918 5:14712057-14712079 AAAGCAGGGTAGGGAAATGATGG - Intronic
987775781 5:22363987-22364009 GAATGAGGGGAGGGGCATGAAGG - Intronic
995109203 5:108409688-108409710 AAATGATGGTATGGGAGTGAAGG + Intergenic
999708968 5:154299614-154299636 AAAGGAGGTTATGGGAATGAAGG - Intronic
1001852983 5:174985529-174985551 AAATACTGGTAGGGGTGTGAGGG - Intergenic
1001979329 5:176028040-176028062 AAAGGATGGGAGGGGGATGAGGG + Intronic
1002064595 5:176645773-176645795 GAATGAGGGTAGGAGTCTGGTGG + Intronic
1002238087 5:177815721-177815743 AAAGGATGGGAGGGGGATGAGGG - Intergenic
1002380457 5:178824400-178824422 AAAGGATGGGAGGGGGATGAGGG + Intergenic
1004212431 6:13662920-13662942 AAAAAAAGGTAGGGGTATGGGGG + Intronic
1004805269 6:19197457-19197479 ACATGAGGGTAGGGGTTGGGAGG - Intergenic
1006500957 6:34458379-34458401 CAAAGAGGGTAGAGATATGATGG + Intergenic
1006931239 6:37689879-37689901 AATAGATGGTAGGGGTTTGAGGG - Intronic
1007334376 6:41141794-41141816 AAAGGAAGGAAGGGGTAAGATGG - Intergenic
1007594034 6:43040481-43040503 ATAAGAGGGTAGGGGGAAGAGGG - Intronic
1008322688 6:50136500-50136522 AAGTGAAGGTAGGGGTAAAATGG - Intergenic
1008983315 6:57512112-57512134 AAAAAAGGATAGTGGTATGATGG + Intronic
1011492960 6:87911513-87911535 AAATGAGAGTGGTGGAATGATGG + Intergenic
1012029832 6:94044882-94044904 GACTGAGGGTAGGGGAATGGAGG + Intergenic
1012367677 6:98462165-98462187 AAATGAGAGTTGTTGTATGAAGG - Intergenic
1013080532 6:106808204-106808226 ACATGAGGGGTGGGGTATGCAGG - Intergenic
1013141560 6:107341161-107341183 AAATGAGGGTAGTGGCAATAGGG + Intronic
1013384476 6:109611441-109611463 AAATCAGGGTTGCTGTATGAAGG - Intronic
1013532142 6:111029865-111029887 GAATGGGGGTAGGGGTGAGATGG - Intergenic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014265402 6:119271200-119271222 AAATTAGGGGAGGGGTATAGTGG - Intronic
1017653112 6:156601110-156601132 AAATGAGGGTGCTGCTATGAAGG + Intergenic
1019331250 7:461895-461917 AGATGAGGTTAGTGGTATCATGG - Intergenic
1021436578 7:20624567-20624589 AATTGAAGGTAGGGGTTGGATGG + Intronic
1021476910 7:21072329-21072351 AAATGAGTGTAGAGGAAAGAGGG + Intergenic
1022125971 7:27357889-27357911 AAATGAGGGAAGGGGTAAGTGGG - Intergenic
1022764850 7:33400551-33400573 AAATGACGGTAAGGGAAGGAAGG - Intronic
1026155054 7:67819028-67819050 AAAGGAGGGGAGGGGAATGGAGG - Intergenic
1028391909 7:90326623-90326645 AAAGGAGGGGAGGGGAATGAAGG + Intergenic
1030681215 7:112436398-112436420 AAATGAATGTAGGGGGATTAGGG + Intronic
1031531690 7:122884848-122884870 AAATGGGGGTAGGAGAATGTAGG + Intronic
1032342410 7:131087112-131087134 AAATGAGGGTGGTGATATTATGG + Intergenic
1032505671 7:132432633-132432655 AACTGAGGGAATGGGTAAGAAGG + Intronic
1032558893 7:132867009-132867031 AAATGATGGTATGTGTATGGTGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1035953889 8:4054414-4054436 ACAAGAGTTTAGGGGTATGATGG - Intronic
1038544776 8:28417385-28417407 AAAACAGGGTAGGGGTTCGAGGG - Intronic
1040580412 8:48694324-48694346 AGCTGAGGGGAGGGGCATGAAGG - Intergenic
1042364251 8:67918256-67918278 CAATGAGGGTGTGGGTAGGATGG + Intergenic
1043291202 8:78603693-78603715 AACTGACTGTAGGGGTTTGATGG - Exonic
1043402332 8:79896298-79896320 GACTGAGGGTAGGGGTGAGAGGG - Intergenic
1044236690 8:89839537-89839559 GAGTGAGGGTGGGGGTAAGAGGG - Intergenic
1044407825 8:91850168-91850190 AAAGGGTGGTTGGGGTATGAGGG + Intergenic
1044494393 8:92859613-92859635 AAATGCAGGTAGGGATATGATGG + Intergenic
1045161695 8:99554808-99554830 GAATGACAGTGGGGGTATGAAGG - Intronic
1045608590 8:103808009-103808031 AAAGGAGGAAAGGGGGATGATGG + Intronic
1047392194 8:124461427-124461449 AAATGAGGGTGGGCAGATGAAGG - Intronic
1048528932 8:135229746-135229768 ACATGAGGGTTTGTGTATGAGGG + Intergenic
1051597032 9:18834619-18834641 TGGTGGGGGTAGGGGTATGAGGG - Intronic
1051906836 9:22105145-22105167 AAATGAGGGTATGTGTATACTGG + Intergenic
1056522280 9:87412118-87412140 AACTGAGGGAAGGGGTTTGGGGG - Intergenic
1056890645 9:90488691-90488713 AAAGGAGGGTAAGGGGATGGAGG + Intergenic
1057195832 9:93115368-93115390 AGATGAAGGAAGGGGAATGAGGG + Intergenic
1057645369 9:96869055-96869077 AACTGAAGGTAAGGCTATGAAGG + Intronic
1058087914 9:100770213-100770235 AAAGGATGGAAGGGGGATGAGGG - Intergenic
1058311490 9:103509218-103509240 AAAAGAGGCAAGGGGAATGAAGG + Intergenic
1059866331 9:118518650-118518672 AAGAGAGGGTAGGGGTAGGGTGG - Intergenic
1060177602 9:121508473-121508495 GAATTAGGGGAGGGATATGATGG + Intergenic
1060569264 9:124623181-124623203 GAAGGAAGGTAGGGATATGATGG + Intronic
1061279455 9:129588881-129588903 AAATGCAGGTAGAGATATGAAGG + Intergenic
1061320722 9:129827091-129827113 AAATGAGGGCACAGGTAAGAAGG + Intergenic
1061656484 9:132095199-132095221 AAAGGATGGGAGGGGGATGAGGG - Intergenic
1062008400 9:134253140-134253162 AACTGAGGGTAGGGATGTGTGGG + Intergenic
1186171342 X:6880243-6880265 AAATGCTGGGAGGGGGATGAGGG - Intergenic
1187279719 X:17848696-17848718 AAATAAGTGTAGGGGCATGGAGG + Intronic
1188300474 X:28501838-28501860 AAATGATGGCAAGGGTAGGAAGG - Intergenic
1188651780 X:32639668-32639690 AAATGAGAGTGTGGTTATGAAGG + Intronic
1188750180 X:33895372-33895394 AGATCAAGGTAGGGTTATGAAGG + Intergenic
1188849034 X:35109810-35109832 AAATGAGGTTTGGGGGATGAGGG - Intergenic
1189833011 X:44994067-44994089 AAGTGAGGTTATGGGTATGTGGG - Intronic
1189879913 X:45479978-45480000 AAATGAAGGTGGGGAAATGAAGG + Intergenic
1190051841 X:47156472-47156494 AAATGAGGGTTGGGGGAAGATGG - Intronic
1190462274 X:50689329-50689351 ACATGAGGGTGGAGGAATGATGG + Intronic
1193562172 X:83031837-83031859 AAAATAGTATAGGGGTATGAGGG - Intergenic
1193663309 X:84283822-84283844 CACTGAGGTTTGGGGTATGAAGG + Intergenic
1194431346 X:93810711-93810733 AAATGAGTTTAGGGGTTTGATGG + Intergenic
1194522196 X:94932424-94932446 AGCTGGGGGTAGGGGTGTGAAGG + Intergenic
1194751161 X:97685422-97685444 ATATGAGGGAAGGGGAAAGAAGG + Intergenic
1197339411 X:125247366-125247388 AAAGGGGGGTGGGGGTAGGAGGG + Intergenic
1197382032 X:125756514-125756536 GAAAGAGGGTTGGGGTAGGAAGG + Intergenic
1199503500 X:148535935-148535957 AAATGTGGGAATGGGAATGAGGG - Intronic
1199872595 X:151912709-151912731 AATTGGGGATGGGGGTATGAGGG - Intronic