ID: 954659248

View in Genome Browser
Species Human (GRCh38)
Location 3:52218151-52218173
Sequence TTCCCAGCACAAGGAAGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954659248_954659251 3 Left 954659248 3:52218151-52218173 CCTCTACTTCCTTGTGCTGGGAA No data
Right 954659251 3:52218177-52218199 CTCTCTGCTCCCCAACACGAGGG No data
954659248_954659256 15 Left 954659248 3:52218151-52218173 CCTCTACTTCCTTGTGCTGGGAA No data
Right 954659256 3:52218189-52218211 CAACACGAGGGGATAACACCAGG No data
954659248_954659252 4 Left 954659248 3:52218151-52218173 CCTCTACTTCCTTGTGCTGGGAA No data
Right 954659252 3:52218178-52218200 TCTCTGCTCCCCAACACGAGGGG No data
954659248_954659257 22 Left 954659248 3:52218151-52218173 CCTCTACTTCCTTGTGCTGGGAA No data
Right 954659257 3:52218196-52218218 AGGGGATAACACCAGGTCCATGG No data
954659248_954659250 2 Left 954659248 3:52218151-52218173 CCTCTACTTCCTTGTGCTGGGAA No data
Right 954659250 3:52218176-52218198 ACTCTCTGCTCCCCAACACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954659248 Original CRISPR TTCCCAGCACAAGGAAGTAG AGG (reversed) Intergenic
No off target data available for this crispr