ID: 954660309

View in Genome Browser
Species Human (GRCh38)
Location 3:52223559-52223581
Sequence CGCCCACATCGAGCACACGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954660304_954660309 19 Left 954660304 3:52223517-52223539 CCATGCAGGGGTTGGGAGCGTGG 0: 1
1: 0
2: 2
3: 21
4: 210
Right 954660309 3:52223559-52223581 CGCCCACATCGAGCACACGCAGG 0: 1
1: 0
2: 0
3: 7
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954660309 Original CRISPR CGCCCACATCGAGCACACGC AGG Exonic
902295920 1:15466964-15466986 TGCCCACATAGACCACCCGCGGG + Intronic
1066648480 10:37634517-37634539 CGCCCACCTGGAACTCACGCTGG - Intergenic
1071287130 10:84159206-84159228 CCCCCACACCTAGCACACCCAGG - Intergenic
1090188996 11:124756312-124756334 CCCCCACATGGGGCACACCCTGG + Exonic
1091807155 12:3365068-3365090 CCCCCAAATCGAACACACCCTGG + Intergenic
1104440498 12:128789736-128789758 GGCCCTCACCGAGCACCCGCAGG + Intergenic
1104985734 12:132595988-132596010 CCCACACCGCGAGCACACGCAGG + Intergenic
1113945260 13:114040303-114040325 CGCTCACTCCGAGCACAAGCGGG + Intronic
1113945268 13:114040362-114040384 CGCTCACTCCGAGCACAAGCGGG + Intronic
1113945276 13:114040421-114040443 CGCTCACTCCGAGCACAAGCGGG + Intronic
1113945284 13:114040480-114040502 CGCTCACTCCGAGCACAAGCGGG + Intronic
1113945294 13:114040539-114040561 CGCTCACTCCGAGCACAAGCGGG + Intronic
1113945304 13:114040598-114040620 CGCTCACTCCGAGCACAAGCGGG + Intronic
1113945311 13:114040657-114040679 CGCTCACTCCGAGCACAAGCAGG + Intronic
1113945320 13:114040717-114040739 CGCTCACTCCGAGCACAAGCGGG + Intronic
1113945327 13:114040776-114040798 CGCTCACTCCGAGCACAAGCAGG + Intronic
1117082569 14:52166791-52166813 CGCCCACCTGGACCTCACGCTGG - Intergenic
1118696072 14:68386519-68386541 CTCCCACATTTAGCACATGCAGG + Intronic
1122860035 14:104578388-104578410 CGCCCAGATTGGGCACAGGCGGG + Intronic
1128482832 15:68054565-68054587 CGCCCACAACAATAACACGCCGG - Intronic
1133369925 16:5239681-5239703 CGCCCGCACCGCGGACACGCCGG - Intergenic
1136079900 16:27845023-27845045 CGCCCACATGATGTACACGCAGG - Exonic
1142969772 17:3603442-3603464 AGCCGGCATCTAGCACACGCGGG - Intergenic
1150978782 17:70119144-70119166 GGCCCACATCCAGAGCACGCTGG + Intronic
1156077807 18:33301602-33301624 GTCCCACATCGAGCACACACTGG - Intronic
1157111020 18:44820414-44820436 CGCCCACATAGAGGACCAGCAGG - Intronic
1160508026 18:79438050-79438072 CCCCCAGATGGAGAACACGCAGG - Intronic
1163124532 19:15237887-15237909 CGCCCGCCTCCAGCCCACGCAGG + Exonic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
929604979 2:43227627-43227649 AGCCCTCATCGAGCAAAGGCTGG - Intergenic
945451511 2:210000887-210000909 CGCCCACCTCGAACTCGCGCTGG + Intergenic
1173164733 20:40679385-40679407 CGCCCTCATGGAGCAAATGCTGG + Intergenic
1175091439 20:56507727-56507749 CACCCACAGGGAGCAGACGCTGG + Intronic
1182743635 22:32587725-32587747 CGCCAGCATCTTGCACACGCTGG - Intronic
1184835576 22:47019114-47019136 CGCCCACATCCAGCACAGGGAGG + Intronic
950203573 3:11061427-11061449 CGCCCACCTGGAACTCACGCTGG - Intergenic
954638841 3:52086080-52086102 CGCCCACATCAACCACAACCCGG - Intronic
954660309 3:52223559-52223581 CGCCCACATCGAGCACACGCAGG + Exonic
955837976 3:63078698-63078720 TGCCCACATCAAGCCCATGCAGG - Intergenic
966183061 3:177204209-177204231 CGCCCACTTGGAACTCACGCTGG + Intergenic
972890445 4:43551259-43551281 CGCCCACCTGGAACTCACGCTGG - Intergenic
973684375 4:53354390-53354412 CGCCCACATGGAACTCACACTGG + Intronic
979445693 4:120808881-120808903 CGCCCACCTGGAACTCACGCTGG + Intronic
985546798 5:514003-514025 CGCCCACACCCAGCACACAGTGG - Intronic
998691741 5:144595179-144595201 CGCCCACCTAGAACACACACTGG - Intergenic
1001564165 5:172688821-172688843 CGCCCACACCCAGCACATGCAGG - Exonic
1002067525 5:176659556-176659578 CCCTCACATGGAGCCCACGCTGG - Intergenic
1002648427 5:180673908-180673930 CAGCCACATCGCGCACACGCGGG - Intergenic
1011129353 6:84037772-84037794 CGCCCACCTAGAACTCACGCTGG + Intronic
1015149167 6:130019560-130019582 CGCACACACACAGCACACGCCGG - Intronic
1017960438 6:159216668-159216690 GGGCCACAGAGAGCACACGCAGG + Intronic
1026429013 7:70325481-70325503 CGCCCATATCTAGGACACACTGG - Intronic
1031401404 7:121329321-121329343 TGCCCACAGCGCGCACAAGCGGG - Exonic
1035379949 7:158431529-158431551 GGCTCACATCGAGCACACACTGG + Intronic
1035379964 7:158431644-158431666 GGCTCACATCGAGCACACACTGG + Intronic
1040026526 8:42786821-42786843 CGCCCACCTGGAACTCACGCTGG - Intronic
1045243410 8:100422281-100422303 CGGCAACATCCAGGACACGCAGG - Intergenic
1049741105 8:144241427-144241449 CTCCCACCTCGAGGACACGCTGG + Exonic
1060599577 9:124869117-124869139 CGCCCACTTCCGGCACCCGCCGG - Exonic
1188166981 X:26873975-26873997 CGCCCACCTGGAACTCACGCTGG + Intergenic
1189467144 X:41286023-41286045 CGCCCACCCAGAGCTCACGCTGG + Intergenic
1196741314 X:119028530-119028552 CGCCCACCTGGAACCCACGCTGG + Intergenic