ID: 954663913

View in Genome Browser
Species Human (GRCh38)
Location 3:52240400-52240422
Sequence CAGTAAATGGAGCTGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954663913_954663919 11 Left 954663913 3:52240400-52240422 CCCAGCTTCAGCTCCATTTACTG 0: 1
1: 0
2: 1
3: 25
4: 298
Right 954663919 3:52240434-52240456 ACCCTCACTAGCCTGCATTGAGG 0: 1
1: 0
2: 1
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954663913 Original CRISPR CAGTAAATGGAGCTGAAGCT GGG (reversed) Intergenic
901453656 1:9351375-9351397 CAGTGAATGGAGCACAGGCTAGG + Intronic
905768604 1:40623303-40623325 CAGTAAATGGAGCCAAGTCTTGG - Exonic
905826296 1:41028249-41028271 AAGTACATGGGCCTGAAGCTGGG - Exonic
907453965 1:54563400-54563422 CAGAAAAGGGAACTGAGGCTTGG - Intronic
907622743 1:55998099-55998121 CACTATAGGGAGCTGAAGTTAGG + Intergenic
908899615 1:68941306-68941328 CATTCTTTGGAGCTGAAGCTTGG - Intergenic
909384219 1:75036830-75036852 CTGTAAAGGGGGCTGAAGCCAGG + Intergenic
909885307 1:80934721-80934743 CAGTGAATGAAACTGAACCTAGG - Intergenic
910708855 1:90157790-90157812 CTGTAAATGGAACAGAAACTCGG - Intergenic
912449784 1:109761718-109761740 CAGTAAATGGCTCTGCTGCTGGG + Exonic
915370709 1:155347625-155347647 CAGGAAATGAAGCAGAAGCTTGG - Intronic
915625277 1:157110702-157110724 CAGTTAATGGAAATGAAGATGGG - Intergenic
915876505 1:159616538-159616560 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
916170001 1:161994673-161994695 CAGTAATTGGAGCTGGGGTTTGG - Intronic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917232823 1:172856244-172856266 CTGGAAATGGGGCTGAAGCCAGG - Intergenic
918206549 1:182314801-182314823 GAGTAAGTGGAGCTGAAAGTAGG + Intergenic
918801208 1:188974540-188974562 TAGTAAATGGAGTTGTGGCTGGG + Intergenic
918808361 1:189080166-189080188 CAGTAAATGTTGCTGAATGTAGG - Intergenic
920970382 1:210738389-210738411 GAGAAAATGTAGCTAAAGCTGGG + Intronic
921626164 1:217379830-217379852 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
924241422 1:242044789-242044811 CAGTGACTGGAGCTGTAACTTGG - Intergenic
924535022 1:244928163-244928185 CAGAAGATGGAGCTGAGGTTTGG + Intergenic
1062773984 10:130033-130055 CAGAGAAGGGAACTGAAGCTGGG + Intergenic
1063301801 10:4855551-4855573 CAGGAATTGGACCTGAACCTGGG - Intergenic
1063564867 10:7163840-7163862 GAGTGCATGGAGCTGAAGCTGGG - Exonic
1065382220 10:25101961-25101983 CAGGAGATGGAGCTGAAGGCAGG + Intergenic
1067347031 10:45444275-45444297 CAGGAAAACGAGGTGAAGCTGGG + Exonic
1067780405 10:49198930-49198952 TATTAAATGGAGGTGAAGATAGG + Intergenic
1068038189 10:51787602-51787624 TACTAAATGGAGGTGAAGATAGG - Intronic
1070747935 10:78946107-78946129 CAGAAACAGGAGCTGAAGCAGGG - Intergenic
1073635000 10:105188835-105188857 CAGTAAAAGGAGTTGAAGCTGGG + Intronic
1073950453 10:108803125-108803147 CAGAAAATGAAGCTGGAGCAGGG + Intergenic
1077174010 11:1180621-1180643 CCGTTACTGGAGTTGAAGCTTGG + Intronic
1077554084 11:3217720-3217742 CAGAAAATGGAGCTGGAGAGAGG - Intergenic
1079057863 11:17222792-17222814 CACTCAATGGGGCTGAAGGTAGG - Intronic
1079316508 11:19412087-19412109 CTGGAAAGGGAGCTGAAGCCAGG + Intronic
1080566323 11:33512852-33512874 CAGCAAATAAATCTGAAGCTTGG + Intergenic
1081372283 11:42318488-42318510 CAGTGAAAGTAGCTAAAGCTTGG - Intergenic
1082823364 11:57560225-57560247 CAGTAAAAGGATCTCAAGCAGGG + Intronic
1083319652 11:61837975-61837997 CAGTAACTGGGGCTGAGGCAGGG + Intronic
1083331425 11:61900178-61900200 CGGTGGATGGGGCTGAAGCTGGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084564967 11:69923501-69923523 CATGAAATGCAGCTGGAGCTAGG + Intergenic
1085433838 11:76481409-76481431 CTGGAAAGGGAGCTGAAGCCAGG + Intronic
1085503287 11:77041170-77041192 AAGTGAGTGGAGCTGGAGCTGGG + Exonic
1086048815 11:82565021-82565043 CTATAAATAGAGCTGAAGTTTGG - Intergenic
1086300356 11:85420912-85420934 CTGGAAATGGGGCTGAAGCCAGG - Intronic
1090207552 11:124894232-124894254 CAGTCACTGGTGCTGGAGCTGGG - Exonic
1091643508 12:2255396-2255418 TAGTAAATGGACCTGGATCTAGG - Intronic
1091815468 12:3434624-3434646 CAGAAAATGGAGCTGATGACAGG + Intronic
1092158607 12:6302194-6302216 CAGGAAAAGGAGCAGAACCTTGG + Intergenic
1093402285 12:18761117-18761139 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
1093610508 12:21149865-21149887 CTGGAAAAGGGGCTGAAGCTAGG + Intronic
1093714479 12:22366101-22366123 CTGGAAAGGGAGCTGAAGCCAGG + Intronic
1093835622 12:23825067-23825089 CTGGAAAGGGGGCTGAAGCTAGG - Intronic
1094366320 12:29686526-29686548 CTGTAGATGGAGCTGATGCTGGG + Intronic
1095045758 12:37502272-37502294 CAGTTTATGGAGATGAAGCAAGG - Intergenic
1095356404 12:41280378-41280400 CTGGAAAGGGAGCTGAAGCCAGG + Intronic
1099526006 12:83720271-83720293 CAGTATATGCTTCTGAAGCTGGG - Intergenic
1102535032 12:113575085-113575107 CATTAAATTGCACTGAAGCTGGG - Intergenic
1103193580 12:119023284-119023306 CACAAAATGGAGATGAAACTGGG + Intronic
1103780373 12:123394851-123394873 CAAAAAATCGAGCTGGAGCTAGG + Intronic
1104260544 12:127178086-127178108 CAGGCAAAGGAGCTGAAGATGGG - Intergenic
1105588222 13:21764354-21764376 CAGTAAATGGAGCTTCAGAGAGG - Intergenic
1105999252 13:25704293-25704315 CAGAAACTGGAGCTGAAGTGAGG - Intronic
1106062196 13:26304575-26304597 GAGTAAATGGAGTTGAAGTTTGG - Intronic
1106120755 13:26858436-26858458 CAGAAAATGGAGCTGGAGCAGGG + Intergenic
1110824663 13:79958285-79958307 CTGGAAATGGGGCTGAAGCCAGG + Intergenic
1110976463 13:81842015-81842037 AAGTAAATATAGCTGTAGCTGGG + Intergenic
1112357697 13:98688636-98688658 CAGTACATGCACCTGAAGTTGGG + Intronic
1113300009 13:109007952-109007974 CAGGAAATGAAGATAAAGCTGGG - Intronic
1113472850 13:110559089-110559111 CAGTGGATGGAGCTGAAGAGGGG - Intronic
1113788892 13:113016936-113016958 CAGTACATGGCTCTGAGGCTGGG - Intronic
1114133580 14:19820906-19820928 CTGGAAATGGGGCTGAAGCCAGG - Intronic
1114233159 14:20801908-20801930 CAGTAGGTGGAGCTGCTGCTGGG + Exonic
1114458812 14:22873936-22873958 CAGTGAATTGAGGTGGAGCTGGG + Intronic
1117544124 14:56777719-56777741 TAGTAAAAGGAGCTAAAGCTGGG - Intergenic
1118985001 14:70746578-70746600 CAGTTAATGATGGTGAAGCTGGG - Intronic
1119436729 14:74602235-74602257 CAGATAAGGAAGCTGAAGCTCGG - Intronic
1120037343 14:79712880-79712902 AAATAAATAGAGCTGAAACTAGG - Intronic
1120338591 14:83190275-83190297 CCGGAAATGGAGCTTAAGCCAGG - Intergenic
1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG + Intergenic
1122280453 14:100619298-100619320 CAGGAAGAGAAGCTGAAGCTGGG + Intergenic
1123576648 15:21676475-21676497 CTGGAAATGGGGCTGAAGCCAGG - Intergenic
1123613270 15:22118943-22118965 CTGGAAATGGGGCTGAAGCCAGG - Intergenic
1124622194 15:31280094-31280116 CAGCACATGGAGCTGGAGCTGGG + Intergenic
1126489829 15:49225004-49225026 CAGTAAATGGTGCTTAAGAGTGG + Intronic
1126790741 15:52218933-52218955 CAGTAAGTGGGGCTGAGGTTGGG - Intronic
1127397189 15:58552351-58552373 CAGTAAAAGGAGCAAAGGCTGGG - Intronic
1127754829 15:62081927-62081949 CAGCAAATGGAGCTCATGCTAGG + Intergenic
1129653628 15:77508475-77508497 CAGACAAGGAAGCTGAAGCTTGG + Intergenic
1130484767 15:84392589-84392611 CAAGTAAAGGAGCTGAAGCTTGG + Intergenic
1131262607 15:90895502-90895524 TGGTAGATGGTGCTGAAGCTGGG - Exonic
1202985516 15_KI270727v1_random:410720-410742 CTGGAAATGGGGCTGAAGCCAGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135274729 16:21102327-21102349 CAGTAAATGCTGTTGAAGTTAGG - Intronic
1136181060 16:28552587-28552609 CAGTAAGTAGAACTGCAGCTGGG + Intergenic
1136287721 16:29254122-29254144 GAGGAAATGGAGCTGGAGGTGGG - Intergenic
1139268647 16:65662301-65662323 GGGTGAATGGAGCTGGAGCTGGG - Intergenic
1140642523 16:76993070-76993092 CAGGAAATGAAGCAGAGGCTGGG + Intergenic
1141049519 16:80747784-80747806 CAGGAAATGGAGATGAGACTTGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142093345 16:88226750-88226772 GAGGAAATGGAGCTGGAGGTGGG - Intergenic
1144751338 17:17650546-17650568 CAGAAAATGGAGCGGAAGTGGGG + Intergenic
1146211657 17:30947945-30947967 CAGTAAATGGGGCTGCAACTGGG + Intronic
1146517958 17:33503984-33504006 GAGGAAATGCAGCTGGAGCTGGG + Intronic
1146746352 17:35333903-35333925 CTGGAAATGGGGCTGAAGCCAGG - Intergenic
1147342873 17:39765217-39765239 TAGGAAATGGATCTGATGCTTGG + Exonic
1148517585 17:48235228-48235250 CAGCAAAGGGACCTGAAGATAGG + Intronic
1148981016 17:51574871-51574893 CTGGAAAGGGGGCTGAAGCTAGG + Intergenic
1149281298 17:55108384-55108406 CTGGAAAGGGAGCTGAAGCCAGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1153986842 18:10358115-10358137 CAGTCAATGGAGCAGAATCTGGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155724284 18:29060222-29060244 CAGTCAATGGAGAAGAAACTTGG + Intergenic
1156139923 18:34095484-34095506 CAGAATATGGACCTGAATCTAGG - Intronic
1156415152 18:36880006-36880028 CTGGAAAGGGAGCTGAAGCCTGG - Intronic
1157067319 18:44366927-44366949 CTGGAAAGGGTGCTGAAGCTAGG - Intergenic
1157068075 18:44374984-44375006 CTGGAAATGGGGCTGAAGCCAGG + Intergenic
1157071727 18:44416385-44416407 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
1158399054 18:57104454-57104476 CTGGAAAGGGGGCTGAAGCTAGG - Intergenic
1159142186 18:64410707-64410729 AAGAAGATGGAACTGAAGCTTGG + Intergenic
1159274664 18:66201290-66201312 CAGTAAATGGTGCTGACAATTGG - Intergenic
1163631885 19:18421685-18421707 CAGGAAAAGGAGCTGGGGCTGGG + Intronic
1164598135 19:29543599-29543621 CAGGACAAGGAGCTGAAGCCTGG + Intronic
1167315323 19:48759526-48759548 CAGGAAAAGGAGCTGAAACCTGG + Intergenic
1168557247 19:57353384-57353406 GAGAAGATGGAGCTGAAGTTTGG + Intronic
924967598 2:92470-92492 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
925730240 2:6914929-6914951 CAGCAAATGGCCCAGAAGCTGGG - Intergenic
931004076 2:57828119-57828141 CCGGAAAGGGAGCTGAAGCCAGG + Intergenic
931061445 2:58533973-58533995 CAGAAAGGGGAGTTGAAGCTTGG + Intergenic
932573226 2:72949197-72949219 CAGGAAATGGAGGTGTGGCTGGG + Intronic
935334170 2:101999746-101999768 CAGCATATGGAGCTGGAGGTTGG - Intronic
935399419 2:102644478-102644500 CTGGAAAGGGGGCTGAAGCTAGG + Intronic
935588854 2:104826538-104826560 CAGTAGATGCAGCAGAAGCAAGG - Intergenic
936640902 2:114312136-114312158 CAGTATGTGGTTCTGAAGCTGGG - Intergenic
938874444 2:135518236-135518258 CTGGAAAGGGGGCTGAAGCTAGG - Intronic
941478031 2:165971947-165971969 CTGGAAAGGGGGCTGAAGCTAGG + Intergenic
942411018 2:175709282-175709304 CTGGAAATGGGGCTGAAGCCAGG + Intergenic
942889337 2:180968528-180968550 CAATAGATGGAACTGAAGTTAGG + Intronic
943822543 2:192345015-192345037 GACTAGATGGAGCTGAAGTTGGG + Intergenic
944267885 2:197748398-197748420 CTGGAAAGGGAGCTGAAGCCAGG + Intronic
945261767 2:207850229-207850251 CAGAAAATCTTGCTGAAGCTTGG - Intronic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
946917317 2:224537616-224537638 CAGTAAAGGAATATGAAGCTTGG - Intronic
947681535 2:232038050-232038072 CAGCAACTGGGGATGAAGCTGGG - Intronic
1169419529 20:5448877-5448899 CAGTAACTGGAGCTGTGGCATGG + Intergenic
1169929153 20:10813334-10813356 CAGTAAATTGAACTGCAGTTTGG + Intergenic
1172345352 20:34194029-34194051 CATTAAATGTGGCTGCAGCTTGG - Intergenic
1173713267 20:45179048-45179070 CAGCAGAAGGAGCTGAAGCTGGG + Intergenic
1173751181 20:45478137-45478159 CTGGAAAGGGGGCTGAAGCTAGG - Intronic
1175231146 20:57474107-57474129 AAATAAATGGACCTGAAGCAAGG - Intergenic
1176511828 21:7754592-7754614 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1178264160 21:31126922-31126944 CAGTAAATGGAGAGTCAGCTGGG - Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178645941 21:34385118-34385140 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1179221188 21:39408841-39408863 TATTCAAGGGAGCTGAAGCTGGG + Intronic
1180596214 22:16975172-16975194 CTGAAAATGGGGCTGAAGCTAGG + Intronic
1180734222 22:18003658-18003680 AAGAAGATGGAGCTGAAGCTTGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183021512 22:35030921-35030943 CTGGAAAGGGAGCTGAAGCCAGG - Intergenic
1184015143 22:41780363-41780385 AAGTGAATGGAGCTGTAGGTAGG + Intronic
1184260882 22:43315283-43315305 CAGTTAGGGGAACTGAAGCTTGG + Intronic
1184293791 22:43511482-43511504 CAGAAGAGGGAGCTGAGGCTCGG + Intergenic
949106300 3:203860-203882 CAGAAAAGGGATCTGAATCTGGG + Intronic
949173899 3:1035103-1035125 CTGGAAAGGGGGCTGAAGCTAGG - Intergenic
949255943 3:2046218-2046240 CAGCACATGGAGCTGAGGCCAGG - Intergenic
949450716 3:4181850-4181872 CACTACATGGACCTGAGGCTGGG + Intronic
949513630 3:4787735-4787757 AAGTTAATGGATCTGAAGTTAGG + Intronic
954663913 3:52240400-52240422 CAGTAAATGGAGCTGAAGCTGGG - Intergenic
956220064 3:66893190-66893212 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
959291870 3:104485112-104485134 CTGAAAAGGGAGCTGAAGCCAGG + Intergenic
960075952 3:113485243-113485265 CTGGAAAGGGGGCTGAAGCTAGG + Intronic
960773174 3:121217158-121217180 CAGGAAAGGGGGCTGAAGCCAGG - Intronic
960992932 3:123323555-123323577 CAGGAAGTGGAGGGGAAGCTGGG - Intronic
962338508 3:134560588-134560610 CACTAACTGGTGCTGAAGCTGGG - Intronic
962880972 3:139576154-139576176 CACTAAATGGAGCAAAAGATGGG + Intronic
963013983 3:140803262-140803284 CTGGAAAGGGGGCTGAAGCTAGG - Intergenic
963693899 3:148540586-148540608 CAGAAAATGGAGCTGGAGTTGGG + Intergenic
963881975 3:150538462-150538484 CAGTAACTAGGGCTGGAGCTAGG + Intergenic
964524520 3:157603962-157603984 CAGGAGATGAAGCTGAAGCCCGG - Intronic
964598624 3:158468530-158468552 TAGTAAATGGCACTGAATCTGGG - Intronic
965732761 3:171790199-171790221 CTGTGAGTGGAGCTGAAGCTTGG - Intronic
965806785 3:172550505-172550527 CAGGGGATGGGGCTGAAGCTAGG - Intergenic
967505669 3:190250092-190250114 CAGTATATGCTTCTGAAGCTGGG + Intergenic
967883680 3:194318798-194318820 CAGCAACTGGAGCTGTACCTGGG + Intergenic
970005298 4:11405208-11405230 AAGTAAATGGAGGGGTAGCTGGG - Intronic
970940338 4:21625426-21625448 GAGTAGAGGAAGCTGAAGCTTGG + Intronic
972743294 4:41909485-41909507 CAGGAAAGGGGGCTGAAGCCAGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
977438987 4:97038072-97038094 CTGGAAAGGGAGCTGAAGCCAGG - Intergenic
977467779 4:97403334-97403356 CTGGAAAGGGGGCTGAAGCTTGG - Intronic
977723503 4:100267749-100267771 CTGGAAAGGGAGCTGAAGCCAGG - Intergenic
978594356 4:110360794-110360816 CAATAAATAGGGCTGAAGCAGGG + Intergenic
979421373 4:120509272-120509294 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
980731009 4:136824191-136824213 CAGTGACTGGAGCGGGAGCTGGG + Intergenic
981877047 4:149559355-149559377 CAGTAAAGGAAGCTGAAGGTAGG - Intergenic
982298981 4:153859708-153859730 CTGGAAAGGGAGCTGAAGCCAGG - Intergenic
982815409 4:159877883-159877905 CTGGAAATGGGGCTGAAGCCAGG - Intergenic
983596331 4:169472088-169472110 CTGGAAAGGGAGCTGAAGCCAGG - Intronic
983791671 4:171806471-171806493 CAGTATTTGGATCTGAAACTTGG + Intergenic
983896891 4:173090698-173090720 CAGTATATGTAGATAAAGCTGGG + Intergenic
983949470 4:173622530-173622552 CTGGAAAGGGGGCTGAAGCTAGG - Intergenic
984622870 4:181973793-181973815 CAGTCAATGGAGCTCAGGGTAGG + Intergenic
985125028 4:186684509-186684531 CAGAAAATGGAACTGACGCTCGG + Intronic
985368904 4:189264070-189264092 CAGTAAATGGGGATGAAGTCAGG + Intergenic
986378851 5:7162780-7162802 CTGGAAAGGGAGCTGAAGCTAGG - Intergenic
987160173 5:15133478-15133500 CTGTCATTAGAGCTGAAGCTAGG - Intergenic
987656515 5:20814795-20814817 CTGGAAATGGGGCTGAAGCCAGG + Intergenic
987768477 5:22267845-22267867 CAGAAAATAGAGCTGAAGCCTGG + Intronic
987924100 5:24317945-24317967 CTGGAAAGGGGGCTGAAGCTAGG - Intergenic
988523553 5:31967136-31967158 CAGGGAATGGAGCGGACGCTGGG + Intronic
988767041 5:34389150-34389172 CTGGAAATGGGGCTGAAGCCAGG - Intergenic
988774962 5:34469259-34469281 CTGGAAATGGGGCTGAAGCCAGG + Intergenic
988789993 5:34598889-34598911 GGGTAAATGGAGCAGAATCTAGG + Intergenic
989240102 5:39193790-39193812 CAGAAAATGGAACGGAATCTGGG + Intronic
991998533 5:72412755-72412777 AAGACAATGGAGGTGAAGCTGGG + Intergenic
993040972 5:82814379-82814401 GAGAAAATGGAGCTGGAGCTTGG - Intergenic
994291763 5:98034890-98034912 CAGTAGCTGCAGCTGAAGCCAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995620595 5:114021414-114021436 CTGGAAAGGGAGCTGAAGCAAGG + Intergenic
997088902 5:130833189-130833211 CAATAAATGGTGCTGGTGCTGGG - Intergenic
997850779 5:137331014-137331036 CAGCAAATGGTGGTGGAGCTAGG + Intronic
998010636 5:138692760-138692782 CAATAAATGGTGCTGGGGCTGGG - Intronic
1000625716 5:163535764-163535786 CAGTAAGTGTACCTGAAACTTGG - Intergenic
1002685760 5:181008186-181008208 CTGGAAAGGGGGCTGAAGCTAGG + Intergenic
1004891072 6:20101277-20101299 CTGTACATGGAGCTGAAGAGGGG - Intergenic
1005255479 6:23998292-23998314 CAGTAAAGTGAGCAGTAGCTTGG - Intergenic
1005801811 6:29432812-29432834 GAGAAAGTGGAGCTGAAGTTAGG - Intronic
1008785093 6:55158469-55158491 CTGGAAAGGGAGCTGAAGCCAGG + Intronic
1009532696 6:64841479-64841501 CAGGAAATGTAGTTGATGCTGGG + Intronic
1011332770 6:86228342-86228364 CTGGAAAGGGAGCTGAAGCCAGG - Intergenic
1011333645 6:86236679-86236701 CTGGAAAGGGGGCTGAAGCTAGG + Intergenic
1013878334 6:114862188-114862210 CAGAAAAATGAGCGGAAGCTGGG + Intergenic
1014584586 6:123182603-123182625 CAGGAAAGGGGGCTGAAGCTAGG + Intergenic
1015623419 6:135156312-135156334 CAGGAAAGGGGGCTGAAGCCAGG - Intergenic
1017197427 6:151716807-151716829 CAGAAAAGGGGGCTGAAGCCAGG - Intronic
1018863615 6:167731148-167731170 AGATAAATGCAGCTGAAGCTAGG + Intergenic
1019003252 6:168773497-168773519 TAGTCAAGAGAGCTGAAGCTGGG - Intergenic
1020629728 7:10625531-10625553 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
1020935472 7:14458866-14458888 CTGGAAAGGGAGCTGAAGCCAGG + Intronic
1021014641 7:15517835-15517857 CTGGAAAGGGAGCTGAAGCCAGG + Intronic
1021149061 7:17127290-17127312 GCGCAAAAGGAGCTGAAGCTTGG + Intergenic
1021225812 7:18025052-18025074 CAACAAATTGAGCTGAAGATAGG - Intergenic
1021392637 7:20112813-20112835 AAGTAATTGGAGCTGAGGCAAGG + Intergenic
1022023927 7:26428152-26428174 CAGAAACTGGGGCTGAATCTAGG - Intergenic
1022469412 7:30673092-30673114 CAGTAAAGGGAACTGAGGGTGGG - Intronic
1026468793 7:70677003-70677025 TAGAAAATGGGGTTGAAGCTAGG - Intronic
1028998384 7:97126772-97126794 CTGGAAAGGGAGCTGAAGCCAGG - Intronic
1029851130 7:103462722-103462744 CTGGAAAGGGAGCTGAAGCCAGG - Intergenic
1030159522 7:106493036-106493058 CTGGAAAGGGGGCTGAAGCTAGG + Intergenic
1030325866 7:108217895-108217917 CTGGAAAGGGAGCTGAAGCCAGG - Intronic
1030801320 7:113856433-113856455 CTGTAAAGGGGGCTGAAGCCAGG + Intergenic
1030803855 7:113889053-113889075 CTGTATATGGAGGTGAAGATGGG + Intronic
1033680027 7:143584560-143584582 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
1033691807 7:143744882-143744904 CTGGAAAGGGAGCTGAAGCCAGG - Intergenic
1035218681 7:157391178-157391200 CAGCAGTTGGAGCAGAAGCTCGG + Intronic
1036740917 8:11361022-11361044 GAGGAAATGGGGCTGCAGCTAGG - Intergenic
1036749707 8:11436055-11436077 CAGTAAAGGTGGGTGAAGCTTGG - Intronic
1036982468 8:13485471-13485493 CAGTAACTGGAACTCTAGCTTGG + Intronic
1037020567 8:13965437-13965459 GAATATATGGAGCTGAAGATGGG - Intergenic
1037737481 8:21579133-21579155 CACTAATCTGAGCTGAAGCTTGG - Intergenic
1037889994 8:22618994-22619016 CACACACTGGAGCTGAAGCTGGG + Exonic
1038430877 8:27498330-27498352 CAGGAAGAGGAGCTGGAGCTAGG + Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1039613068 8:38934373-38934395 CAATAAAAGGAGATGAATCTCGG - Intronic
1039889473 8:41674379-41674401 GAGCAACAGGAGCTGAAGCTGGG - Intronic
1041571909 8:59346801-59346823 CAGTAAATGTAGCTGATGTCTGG + Intergenic
1041583978 8:59495065-59495087 CTGAAAAGGGAGCTGAAGCCAGG - Intergenic
1041594775 8:59636140-59636162 AAGGAAATGAGGCTGAAGCTGGG - Intergenic
1041666298 8:60448231-60448253 CTGTAAAGGGGGCTGAAGCCAGG + Intergenic
1041700690 8:60786081-60786103 CAGGAAAGGGAGCACAAGCTTGG - Intronic
1041838355 8:62242213-62242235 CAGAAAAGGGGGCTGAAGCCAGG - Intergenic
1042186762 8:66143598-66143620 CACTGAATGAAGCAGAAGCTTGG + Intronic
1043539404 8:81242643-81242665 CAGTAACTGCTGCTGAAGCTGGG + Intergenic
1044531900 8:93316734-93316756 CAGGGATTGGAGCTGAAGGTAGG - Intergenic
1044746920 8:95379456-95379478 CAGTAAATGGGGCAGAATGTAGG - Intergenic
1046233312 8:111387022-111387044 AAGCACATGGAGCTGCAGCTAGG - Intergenic
1047647336 8:126882570-126882592 CACTAAAGGGAGCGGGAGCTGGG - Intergenic
1051298137 9:15618495-15618517 CTGGAAAGGGAGCTGAAGCCAGG - Intronic
1051814299 9:21087387-21087409 CTGTAAAGGGGGCTGAAGCCAGG + Intergenic
1054884936 9:70185856-70185878 CTGGAAAGGGAGCTGAAGCCAGG - Intronic
1055210297 9:73783198-73783220 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
1057098395 9:92333865-92333887 TAATGAATGTAGCTGAAGCTAGG + Intronic
1057466746 9:95321148-95321170 CTGTAAATGGAGTTGAAGCCAGG - Intergenic
1058851430 9:109014810-109014832 AAGAAAAAGAAGCTGAAGCTTGG - Intergenic
1059902643 9:118945401-118945423 CAGTAAATGGATCTGAGTCCTGG + Intergenic
1060766702 9:126299443-126299465 TAGTAAATATAGCTGGAGCTTGG + Intergenic
1061296565 9:129679923-129679945 CAGCAAGTGGAGCTGAGGTTGGG - Intronic
1061977959 9:134081793-134081815 CAAAAAATGAAGTTGAAGCTGGG + Intergenic
1062262994 9:135672109-135672131 CAGGAAGTGGCGCTGGAGCTGGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187281915 X:17863927-17863949 AAGTGAAGGGAACTGAAGCTGGG + Intergenic
1187321397 X:18241309-18241331 AAGTATATGGGGCTGAAGCTGGG - Exonic
1189203963 X:39221833-39221855 AGGTATATGGAGCTGGAGCTTGG + Intergenic
1189514203 X:41694941-41694963 CAGGAAGTGGTTCTGAAGCTGGG + Intronic
1190288867 X:48978596-48978618 CAGAAAAAAGAGCTGAGGCTGGG + Intronic
1191757789 X:64613043-64613065 GAGAAAATTGAGATGAAGCTAGG - Intergenic
1191795636 X:65018698-65018720 CTGGAAAGGGGGCTGAAGCTAGG + Intronic
1192128997 X:68530442-68530464 CTGGAAAGGGAGCTGAAGCCAGG - Intronic
1192181172 X:68916634-68916656 CAGAAACTGGAGCTGGAGTTGGG - Intergenic
1193010617 X:76671197-76671219 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
1193034457 X:76934390-76934412 CTGGAAAGGGAGCTGAAGCCAGG + Intergenic
1193350828 X:80462646-80462668 CTGGAAAGGGGGCTGAAGCTAGG + Intergenic
1193382193 X:80828163-80828185 CTGGAAATGGGGCTGAAGCCAGG - Intergenic
1193398117 X:81010215-81010237 CTGGAAAGGGGGCTGAAGCTAGG - Intergenic
1194315307 X:92369489-92369511 CTGGAAAGGGAGCTGAAGCCAGG - Intronic
1194460381 X:94159719-94159741 CAGGAGATGGAGCAGTAGCTGGG + Intergenic
1194963989 X:100266992-100267014 CTGGAAAGGGGGCTGAAGCTAGG + Intergenic
1195168356 X:102242273-102242295 CAATAAATGGCGCTGGTGCTGGG - Intergenic
1195190501 X:102444814-102444836 CAATAAATGGCGCTGGTGCTGGG + Intronic
1195877453 X:109557019-109557041 TAGTAACTGAAGGTGAAGCTTGG + Intergenic
1196185190 X:112738015-112738037 CAGGAAATGGGCCTGAAGGTTGG - Intergenic
1197142176 X:123129804-123129826 CAGGAAAGGGGGCTGAAGCCAGG + Intergenic
1198033627 X:132779934-132779956 CAGTGGGTGGAGCTGGAGCTAGG - Intronic
1199019514 X:142860743-142860765 CAGACAATGAAGCTCAAGCTGGG + Intergenic
1200250505 X:154551352-154551374 GAATAAATGGGGCAGAAGCTTGG - Intronic
1200333207 X:155319724-155319746 CTGGAAAGGGGGCTGAAGCTAGG + Intronic
1200623355 Y:5481024-5481046 CTGGAAAGGGAGCTGAAGCCAGG - Intronic
1201376716 Y:13330677-13330699 CTGGAAAAGGAGCTGAAGCCAGG + Intronic
1202342266 Y:23882266-23882288 CTGGAAAGGGGGCTGAAGCTAGG - Intergenic
1202373328 Y:24212698-24212720 CAAGTAAAGGAGCTGAAGCTTGG - Intergenic
1202497453 Y:25457422-25457444 CAAGTAAAGGAGCTGAAGCTTGG + Intergenic
1202528503 Y:25787819-25787841 CTGGAAAGGGGGCTGAAGCTAGG + Intergenic