ID: 954665236

View in Genome Browser
Species Human (GRCh38)
Location 3:52248044-52248066
Sequence TCATGGACAGAGCTGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954665225_954665236 26 Left 954665225 3:52247995-52248017 CCTTCACCCTTGCAGGTCTTAGG 0: 1
1: 0
2: 1
3: 19
4: 145
Right 954665236 3:52248044-52248066 TCATGGACAGAGCTGGATCCTGG 0: 1
1: 0
2: 1
3: 22
4: 201
954665227_954665236 20 Left 954665227 3:52248001-52248023 CCCTTGCAGGTCTTAGGTAGTCA 0: 1
1: 0
2: 0
3: 5
4: 77
Right 954665236 3:52248044-52248066 TCATGGACAGAGCTGGATCCTGG 0: 1
1: 0
2: 1
3: 22
4: 201
954665228_954665236 19 Left 954665228 3:52248002-52248024 CCTTGCAGGTCTTAGGTAGTCAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 954665236 3:52248044-52248066 TCATGGACAGAGCTGGATCCTGG 0: 1
1: 0
2: 1
3: 22
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954665236 Original CRISPR TCATGGACAGAGCTGGATCC TGG Intronic
900483423 1:2910292-2910314 TCAGGGCCAGAGCTGTGTCCTGG - Intergenic
900846026 1:5101733-5101755 TCATGGACAGAGCTGGTGGGAGG + Intergenic
902618292 1:17635739-17635761 TCCTGGACAGAGCTGCAGCCAGG - Intronic
902623754 1:17665018-17665040 GCATGGGCAGTGCTGGAACCAGG - Intronic
903040871 1:20529271-20529293 TCATGGTCAAAGATGGATGCTGG - Intergenic
903563455 1:24246377-24246399 TCTTGCACAGAGCTTGATTCGGG + Intergenic
903931440 1:26864605-26864627 TGATGGAGAGAGCCGGACCCCGG - Intergenic
904889222 1:33765908-33765930 TCCTAGACAGGGCTGGAACCAGG + Intronic
905251104 1:36648998-36649020 TGATGGAGGGAGCAGGATCCAGG - Intergenic
908124190 1:61013837-61013859 TCATGGAGAGAGCTAGAGCAGGG + Intronic
909069950 1:70982029-70982051 TACTGGACAGAGGTGGATCCAGG + Intronic
913091231 1:115478106-115478128 TGCTGGACAGAGCTGGATTCTGG + Intergenic
914899006 1:151702132-151702154 AGAGGGACAGAGCTGGATACAGG + Intergenic
915436878 1:155913558-155913580 TGTTGGATATAGCTGGATCCTGG - Exonic
915509244 1:156377549-156377571 TGAAGGACAGGGCTAGATCCGGG - Intronic
920182191 1:204138768-204138790 ACATGGACGGAGCTGGACACTGG - Intronic
920502272 1:206492918-206492940 ACATGGACACAGGTGGGTCCCGG - Exonic
920867601 1:209766242-209766264 TCATTGACAGAGCAGGAACTTGG + Intronic
922205638 1:223443685-223443707 GCATGGGAAGAGCTGGCTCCTGG - Intergenic
923014005 1:230112095-230112117 CCATGGACTGGGCTGGACCCAGG - Intronic
924777343 1:247119334-247119356 TCATGCACCCAGCTGGGTCCTGG + Intergenic
1063630110 10:7725479-7725501 TCATGATCAGAGCTGGATTCTGG + Intronic
1064218521 10:13420017-13420039 ACATGGAAAAAGCTGGAGCCCGG - Intergenic
1064748873 10:18505102-18505124 TCAAGGACAAATCTGCATCCTGG + Intronic
1067658878 10:48218684-48218706 TCTTGCACAGGGCTGGAACCTGG + Intronic
1067840155 10:49669273-49669295 ACAAGGACAGAGCTGGTCCCTGG - Intergenic
1068116212 10:52740239-52740261 ACATGGGCAGAGCTGGAGCCTGG + Intergenic
1068623884 10:59218149-59218171 TTATAGACAGGGCTGGATCCAGG + Intronic
1068699444 10:60004164-60004186 CCATGATCAGAGCTGGCTCCAGG + Intergenic
1070802004 10:79249272-79249294 TGATGTACAGCGCTGGATCCTGG - Intronic
1071566306 10:86673086-86673108 TCCTGGGCAGAGGTGGAGCCTGG - Intronic
1074432268 10:113404159-113404181 TCATGCACAGAGCTGGGAGCTGG + Intergenic
1076127578 10:127987545-127987567 TCCTGCACAGAGCTGGATAAAGG - Intronic
1076288628 10:129326317-129326339 TCACAGTCAGAGCTGGAGCCAGG - Intergenic
1076356873 10:129859699-129859721 TCAGTGACAGTGCTGGAGCCTGG - Intronic
1076622976 10:131804632-131804654 TCACGTCCAGAGATGGATCCTGG - Intergenic
1078825753 11:14928871-14928893 TCATGGAGAAAGCTGGATAGAGG + Intronic
1078898332 11:15617984-15618006 TCATGGATCCATCTGGATCCAGG - Intergenic
1081652408 11:44833164-44833186 CAATGGACAGGGCAGGATCCTGG + Intronic
1082170829 11:49002865-49002887 TCATGGCTAGAGCTGTATCTAGG - Intergenic
1083155483 11:60820496-60820518 TCCTGGAGGGAGCTGGAGCCTGG - Intergenic
1084601831 11:70150222-70150244 GCAGGCACAGAGCTGGCTCCAGG - Intronic
1085049782 11:73374417-73374439 TCAGGGTCAGAGCTGGCTGCAGG + Intergenic
1086711119 11:90010643-90010665 TCATGGCTAGAGCTGTATCTAGG - Intergenic
1086857352 11:91880888-91880910 CCATGAACAGAAGTGGATCCAGG + Intergenic
1087017449 11:93567690-93567712 TCATTGCCAGAGCTGGATTTTGG + Intergenic
1087842639 11:102935846-102935868 TCAGGGACAGACCTGGACTCTGG + Intergenic
1088150783 11:106742484-106742506 TCAGGGACACAGATGGTTCCTGG - Intronic
1088706441 11:112468380-112468402 TGGTGGGCAGAGCTGGTTCCTGG + Intergenic
1089062891 11:115640551-115640573 TCAGGGACAGCGGTGGAGCCAGG - Intergenic
1089811885 11:121138772-121138794 TCATGTGCAGAGCAGGACCCTGG - Intronic
1090918929 11:131191510-131191532 TCAAGGACAGAGCTGGGCACGGG + Intergenic
1091629413 12:2148423-2148445 TCATGGCCAGACCAGGCTCCAGG + Intronic
1095917803 12:47497730-47497752 TCCTGGAAAGGGCTGAATCCAGG + Intergenic
1100543630 12:95580957-95580979 TCATGACCAGAGCTGGAGCACGG - Intergenic
1101675508 12:106913286-106913308 TCCTGGAGAGCTCTGGATCCTGG + Intergenic
1101738497 12:107481714-107481736 CCTTTGACACAGCTGGATCCAGG + Intronic
1101953732 12:109196234-109196256 TCCTGGGCAGAGCTGGGTCTGGG + Intronic
1102489123 12:113278313-113278335 GCAGGGAGAGAGCTGGATCTCGG - Intronic
1102639055 12:114350277-114350299 TCAGTGACAGAGCTGGGTACTGG - Intergenic
1103478241 12:121233870-121233892 TCCTGGAGAGAGCTGGAGACAGG - Exonic
1105635713 13:22213332-22213354 TCCTGAACCGAGCTGGGTCCAGG + Intergenic
1106883856 13:34161266-34161288 TCATGGACAGTGCTGGTTTATGG + Intergenic
1107834836 13:44404836-44404858 CCCTGGACAGAGATGGGTCCTGG - Intergenic
1115309135 14:31961901-31961923 TCATGGAGAGAGCTGCACCAGGG + Intergenic
1117841940 14:59869915-59869937 CCCTGGACAGAGCCGGGTCCAGG + Intronic
1118860197 14:69657020-69657042 TCATGAACAGAGCTGGCCACTGG - Intronic
1122354915 14:101117079-101117101 TGACAGACAGAACTGGATCCTGG - Intergenic
1122918053 14:104867872-104867894 GCAGGGACAGAGCTGGAGACAGG - Intronic
1124964418 15:34422785-34422807 CTGTGGACAGAGCTGGCTCCTGG - Intronic
1124981037 15:34569011-34569033 CTGTGGACAGAGCTGGCTCCTGG - Intronic
1125874677 15:43133683-43133705 GCAGGGCCAGAGCTGGATGCGGG - Exonic
1127304515 15:57691543-57691565 TCATCGAAAAAGCTGCATCCTGG - Intronic
1129256041 15:74334689-74334711 TCATAGACAGAGCCTGACCCTGG - Intronic
1129477123 15:75792971-75792993 ACATGGCCAGAGCTGGTGCCAGG + Intergenic
1130910982 15:88270598-88270620 TCCTGGACAGTGCTGGATGCTGG - Intergenic
1131252100 15:90837676-90837698 TGCTGGACAGGGCTGGGTCCAGG + Intergenic
1131336278 15:91552438-91552460 TCATGGTTGGAGCTGAATCCAGG + Intergenic
1132667872 16:1090237-1090259 TCAGGGAAAGAGGTGGATGCCGG + Exonic
1134450025 16:14357703-14357725 TGATGGACAGAGGAGGAGCCTGG - Intergenic
1134654648 16:15939003-15939025 TCATGGGTAGGGCTGAATCCAGG + Intergenic
1136121520 16:28138803-28138825 TTATGGTCAGAGATGGATGCTGG - Intronic
1136491055 16:30608787-30608809 TCATGGTCAGATCTGAATCTTGG + Intronic
1140132119 16:72172229-72172251 TCATGCACAGAGGTGCATCATGG + Exonic
1141894591 16:86950780-86950802 CCAGGCACAGTGCTGGATCCTGG - Intergenic
1142050561 16:87955259-87955281 TGATGGACACAGCTGGCCCCTGG - Intronic
1142769190 17:2084423-2084445 TCCAGGACAGAGGTGGTTCCAGG - Intronic
1144560553 17:16317423-16317445 TGACTGACAGAGCTGGAACCAGG + Intronic
1146283027 17:31557731-31557753 GCATGGACAGCGCTGGCCCCAGG - Intergenic
1146485761 17:33241258-33241280 TCTTGAACAGAGGTAGATCCAGG + Intronic
1150176806 17:63066137-63066159 TCAGGGTCAGGCCTGGATCCTGG + Intronic
1151202025 17:72475703-72475725 TTGTGGGCAGACCTGGATCCAGG - Intergenic
1152161783 17:78673351-78673373 TAATTGACAGAGATGGATCCAGG + Intergenic
1152702997 17:81828746-81828768 GCATGGACATAACTGGAGCCGGG + Intronic
1152735148 17:81993634-81993656 CCATGCACAGAGCGGGATGCTGG - Intronic
1153352142 18:4092757-4092779 TCAAGGACAGAGCTGGAGACAGG - Intronic
1154438334 18:14363729-14363751 TCATGGACTGAGTTAGAGCCAGG - Intergenic
1158951453 18:62499213-62499235 TCATGAACAGATCTTGATCTGGG - Intergenic
1161310634 19:3592180-3592202 TCCTGGGCAGCGCTGGGTCCTGG - Exonic
1161583391 19:5092604-5092626 TCATGGACAGAGCTGGTTCGGGG + Intronic
1162410196 19:10501192-10501214 TCATGGAAACCCCTGGATCCTGG + Intronic
1164559070 19:29276140-29276162 TGATGGAGACAGCTGGAGCCTGG - Intergenic
1165352701 19:35284814-35284836 CCCAGGACAGAGCTGGAGCCAGG + Exonic
1166198435 19:41221093-41221115 TCAGGGTCAGAGCTGGACACTGG - Intronic
1166272768 19:41727145-41727167 TCATGCTGAGAGCTGGAACCTGG + Intronic
1166300712 19:41910602-41910624 ACATGCACAGAGCTGCAGCCTGG - Intronic
1167797106 19:51716688-51716710 TCAAAGACAGAGTTGGAGCCAGG - Intronic
926380994 2:12289001-12289023 CCTTGGACAGAGCTGGAACTTGG + Intergenic
929728543 2:44459866-44459888 TAATGGACTGAGCTGGGTGCTGG + Intronic
930736872 2:54788355-54788377 TCCTGGTCAGGGCTGGACCCAGG + Intronic
932274739 2:70443368-70443390 TCATTGACAGAGCTGCCTGCTGG - Intergenic
932333907 2:70918483-70918505 TAATGGAAAGAGCTGTATTCGGG - Intronic
932427690 2:71651532-71651554 TCAAAGAGAGAGCTGGAGCCAGG + Intronic
932770952 2:74500522-74500544 TCACGGACCCAGCTGGATCTTGG + Intronic
933300349 2:80533620-80533642 GCATTGCCAGAGATGGATCCTGG + Intronic
934652961 2:96102939-96102961 GCAGGGACAGACCTGCATCCAGG - Intergenic
934670977 2:96212604-96212626 TCTTGCACTGAGCTGGTTCCCGG - Intergenic
936861886 2:117029222-117029244 TCAGGGAAACAGCTGGACCCAGG + Intergenic
937153319 2:119701030-119701052 CCAAGGACAGAGCTGGAGGCAGG + Intergenic
937214011 2:120299138-120299160 TGATGGACAGAGCTGCCTGCAGG + Intergenic
938186902 2:129239996-129240018 CCACGAACAGAGCTGGGTCCAGG + Intergenic
938600848 2:132837762-132837784 GCATGGACAGGGCTTGTTCCTGG + Intronic
940793583 2:158053528-158053550 CCATGTACAGGGCTGGATTCAGG + Intronic
946217320 2:218194687-218194709 TCAGGGACATAGCTGGAGCTGGG - Intergenic
948268340 2:236655062-236655084 CCTTGTCCAGAGCTGGATCCTGG + Intergenic
949072225 2:242032729-242032751 TCGTGAGCAGAGCTGGATGCGGG - Intergenic
1168878500 20:1186518-1186540 TCATGGACAGAAGTGGATACAGG - Intronic
1169300991 20:4441791-4441813 TCATGGAAAGTGGTAGATCCAGG - Intergenic
1170205406 20:13792652-13792674 AGATGGAGAGAGCAGGATCCCGG + Intronic
1174417989 20:50380168-50380190 TCATGAGAAGAGCCGGATCCAGG + Intergenic
1175585216 20:60133725-60133747 TCAGGGACAGAGCTGGGGCCTGG + Intergenic
1178437918 21:32575779-32575801 GCATGGACAGAACTGGGGCCTGG + Intergenic
1180712399 22:17848260-17848282 TCATGGACAGGGCTGTAAGCGGG + Intronic
1182071217 22:27465071-27465093 CCAGGGACAGGGCTGGCTCCTGG + Intergenic
1182614786 22:31579761-31579783 TTATTGATGGAGCTGGATCCAGG + Intronic
1182792180 22:32961988-32962010 TGATGGACAGAGCTGTACCCGGG - Intronic
1183091733 22:35526918-35526940 TGGTGGACAGAGCTGGAACAAGG + Intergenic
950604194 3:14064015-14064037 TCAAGAACAGAGCAGGACCCAGG + Exonic
954665236 3:52248044-52248066 TCATGGACAGAGCTGGATCCTGG + Intronic
955152907 3:56386407-56386429 TGATGGAAAGAACTGGATCATGG + Intronic
955564865 3:60233290-60233312 TAATGGACAAAGCTGGGTACTGG - Intronic
959587955 3:108042778-108042800 TCAGACACACAGCTGGATCCTGG - Intergenic
959996361 3:112684745-112684767 TGATGGGCAGAGCTAGAGCCTGG + Intergenic
960053706 3:113261246-113261268 TCAGAGCCAGAGCTGGATCCTGG - Intronic
960944719 3:122958208-122958230 TCATGGACTGAGCTGGAGGTGGG - Intronic
963259573 3:143178560-143178582 TGATGGACAGGCCTGGAGCCAGG - Intergenic
963380964 3:144529813-144529835 TCATGGACAGACCTGCACCAGGG + Intergenic
963839269 3:150088618-150088640 ACATGGAAAGGGATGGATCCTGG - Intergenic
966305109 3:178522982-178523004 TCAGGCACAGAGCTAGATACTGG + Intronic
966816776 3:183896189-183896211 CTAGGCACAGAGCTGGATCCTGG - Intergenic
968022493 3:195405845-195405867 ACATGGCCAGAGCAGGAGCCAGG + Intronic
968331534 3:197874600-197874622 CCATGGACAGGGCTGGAGCTGGG - Intronic
968516032 4:1016039-1016061 TCAAGGACAGAGCTGGGGACAGG - Intronic
968901741 4:3435316-3435338 TCTTGGACAGAGCAGGAGCCAGG - Intronic
969701280 4:8769168-8769190 TCAGGGACAGAGCTGGATGGGGG + Intergenic
969859114 4:10021811-10021833 TCAGGGGCAGAGCTGTATGCAGG - Intronic
970023672 4:11597145-11597167 TCATAGACAGGGCTGGACGCTGG - Intergenic
972338347 4:38128613-38128635 ACTGGGACACAGCTGGATCCTGG + Intronic
972354467 4:38267503-38267525 CCATGGACAGAGCAGGAACCTGG + Intergenic
973639560 4:52889370-52889392 TCATGCACAGTAATGGATCCAGG + Intronic
980991885 4:139745240-139745262 CCATGGACAGATCTGCATGCAGG + Intronic
981256195 4:142662525-142662547 ACATGGACAAACCTGAATCCAGG - Intronic
985508341 5:298117-298139 TCATGAGCAGAGCTGGATGCTGG - Intronic
985561329 5:587675-587697 TTGTGGCCAGAGCTGGAGCCGGG - Intergenic
985679767 5:1249755-1249777 CCCTGGTCAAAGCTGGATCCAGG + Intergenic
985739702 5:1607555-1607577 TCATGAGCAGAGCTGGATGCTGG + Intergenic
986506952 5:8461931-8461953 TCAGGGACACAGCTGGATGGAGG - Intergenic
991592891 5:68273017-68273039 TTATGGGGAGAGCTGGATCCTGG + Intronic
996212382 5:120827364-120827386 CAATGGACAGATCTGGAACCTGG - Intergenic
996302692 5:122007684-122007706 TCTGGGACAGACCTGGACCCTGG + Intronic
996766158 5:127035988-127036010 TCCTGGAGAGAGTTGGATTCAGG + Intergenic
997585195 5:135039684-135039706 CCAGAGCCAGAGCTGGATCCGGG - Intronic
999856266 5:155597754-155597776 TCATGCACAGTGCTTGATACTGG + Intergenic
1001250678 5:170144492-170144514 TCGTGGACAGAGTTGGTGCCAGG + Intergenic
1001580621 5:172795684-172795706 TCATGGAAAGATCAGGCTCCTGG - Intergenic
1002328210 5:178423802-178423824 TCATGGGCAGGCCGGGATCCAGG - Intronic
1002717147 5:181234753-181234775 TCAAGGGCAGAGCTTGATGCGGG - Exonic
1004993206 6:21162471-21162493 TCAAGGCCAGAGCTGGTTCTGGG - Intronic
1005895289 6:30172392-30172414 CCAGGGGCGGAGCTGGATCCCGG - Exonic
1006186695 6:32185420-32185442 TGATGGACAGGCCTGGAGCCAGG + Exonic
1010942043 6:81930574-81930596 CCATCCATAGAGCTGGATCCAGG + Intergenic
1011207258 6:84913262-84913284 TCGTGGGAAGAGTTGGATCCTGG + Intergenic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1013566449 6:111369007-111369029 GCAGGGACAGTGCTGGATGCTGG - Intronic
1015290953 6:131538011-131538033 CCATGGACAGAGTTGGAAGCTGG + Intergenic
1016204952 6:141457969-141457991 TGATGGACAGAGCTTTATTCTGG - Intergenic
1018795098 6:167179530-167179552 GCATGGACAGAGCTGGGCTCAGG - Intronic
1018821220 6:167375532-167375554 GCATGGACAGAGCTGGGCTCAGG + Intronic
1020047672 7:5054731-5054753 ACATGGACAAAACTGGATCCAGG - Intronic
1020118599 7:5490356-5490378 TCCTGGAGAGAGCTGGAGCTTGG - Intronic
1020468003 7:8502956-8502978 CCATGGTAAGGGCTGGATCCTGG + Intronic
1023448449 7:40256022-40256044 TCCTTGACAGAGTTGGATCAGGG + Intronic
1026378499 7:69775692-69775714 TACTGGTCAGAGCTGGATTCAGG + Intronic
1026728190 7:72888162-72888184 ACATGGATAAAACTGGATCCAGG - Intronic
1028241110 7:88421836-88421858 TCATGGTCCAAGATGGATCCTGG - Intergenic
1028871460 7:95774755-95774777 TTATGGACAGAGCAGCACCCAGG - Intronic
1029721897 7:102373007-102373029 ACATGGATAAAACTGGATCCAGG - Intronic
1030737316 7:113064998-113065020 TCATGGTCAGAGCTGTCTCCAGG + Intergenic
1034378182 7:150664990-150665012 TCATGGAAAGAGCAGCAGCCTGG - Intergenic
1034554207 7:151839712-151839734 CTATGGACAGAGCTAGAGCCTGG - Intronic
1035361109 7:158314920-158314942 TCAAGGACAGAGGTGAACCCGGG + Intronic
1035361147 7:158315036-158315058 TCAAGGACAGAGGTGAACCCGGG + Intronic
1035361155 7:158315065-158315087 TCAAGGACAGAGGTGAACCCGGG + Intronic
1035361203 7:158315210-158315232 TCAAGGACAGAGGTGAACCCGGG + Intronic
1035361251 7:158315355-158315377 TCAAGGACAGAGGTGAACCCGGG + Intronic
1035361266 7:158315413-158315435 TCAAGGACAGAGGTGAACCCAGG + Intronic
1035361290 7:158315500-158315522 TCAAGGACAGAGGTGAACCCGGG + Intronic
1037691008 8:21181606-21181628 TCTTGGAGACAGCTTGATCCAGG + Intergenic
1037948654 8:23004835-23004857 TCAGGGACTGAGCTGGTGCCTGG + Intronic
1039066982 8:33617507-33617529 GCAAGGACAGGCCTGGATCCTGG + Intergenic
1040898797 8:52395502-52395524 TCATGGGGAGAGCTGGATTGTGG + Intronic
1043577657 8:81676580-81676602 TCATCTCCAGAGATGGATCCTGG + Intronic
1047903304 8:129446853-129446875 TTCTAGACATAGCTGGATCCAGG + Intergenic
1049531272 8:143156824-143156846 TCATGGCCACTGCTGGGTCCTGG - Intergenic
1051131232 9:13863241-13863263 TCTTGGACAGAGCTAGCTTCTGG + Intergenic
1052984945 9:34480046-34480068 TCAGTGACAGAGCTGGAAGCAGG + Intronic
1057567485 9:96178375-96178397 TCAGGGAGAGGGCTGGAGCCAGG - Intergenic
1059420262 9:114186234-114186256 TCCAGCACAGAGTTGGATCCAGG + Intronic
1059744234 9:117184488-117184510 TCAGGGACAGTCCTGGAGCCAGG + Intronic
1061324270 9:129853497-129853519 CCATGGGCAGAGCTGCATGCAGG + Intronic
1203748608 Un_GL000218v1:58384-58406 TGGTGGACAGGGCTGGATCGCGG + Intergenic
1186030829 X:5367315-5367337 ACAAGGATAAAGCTGGATCCTGG - Intergenic
1191896151 X:65995551-65995573 TTATGAGCAGAGCTGAATCCAGG + Intergenic
1197768926 X:130077095-130077117 TCATGGACAGCTCTAGATGCTGG - Intronic
1199991284 X:152988987-152989009 TCCTGGCAAGAGGTGGATCCTGG - Exonic