ID: 954672178

View in Genome Browser
Species Human (GRCh38)
Location 3:52297088-52297110
Sequence GTCCTCCCTCACCTCAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954672178_954672185 10 Left 954672178 3:52297088-52297110 CCCAGACTGAGGTGAGGGAGGAC No data
Right 954672185 3:52297121-52297143 CCAGGCCAGAATCCGTAGCTAGG No data
954672178_954672189 23 Left 954672178 3:52297088-52297110 CCCAGACTGAGGTGAGGGAGGAC No data
Right 954672189 3:52297134-52297156 CGTAGCTAGGTAAGAGGATTTGG No data
954672178_954672187 17 Left 954672178 3:52297088-52297110 CCCAGACTGAGGTGAGGGAGGAC No data
Right 954672187 3:52297128-52297150 AGAATCCGTAGCTAGGTAAGAGG No data
954672178_954672190 24 Left 954672178 3:52297088-52297110 CCCAGACTGAGGTGAGGGAGGAC No data
Right 954672190 3:52297135-52297157 GTAGCTAGGTAAGAGGATTTGGG No data
954672178_954672181 -8 Left 954672178 3:52297088-52297110 CCCAGACTGAGGTGAGGGAGGAC No data
Right 954672181 3:52297103-52297125 GGGAGGACTGGCTTAACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954672178 Original CRISPR GTCCTCCCTCACCTCAGTCT GGG (reversed) Intergenic
No off target data available for this crispr