ID: 954672868

View in Genome Browser
Species Human (GRCh38)
Location 3:52299856-52299878
Sequence CCCAGGGAGGAGGGCAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954672855_954672868 9 Left 954672855 3:52299824-52299846 CCTCTTAGGGAGAGTGTGTGCCC No data
Right 954672868 3:52299856-52299878 CCCAGGGAGGAGGGCAGGGTAGG No data
954672853_954672868 11 Left 954672853 3:52299822-52299844 CCCCTCTTAGGGAGAGTGTGTGC No data
Right 954672868 3:52299856-52299878 CCCAGGGAGGAGGGCAGGGTAGG No data
954672852_954672868 12 Left 954672852 3:52299821-52299843 CCCCCTCTTAGGGAGAGTGTGTG No data
Right 954672868 3:52299856-52299878 CCCAGGGAGGAGGGCAGGGTAGG No data
954672854_954672868 10 Left 954672854 3:52299823-52299845 CCCTCTTAGGGAGAGTGTGTGCC No data
Right 954672868 3:52299856-52299878 CCCAGGGAGGAGGGCAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954672868 Original CRISPR CCCAGGGAGGAGGGCAGGGT AGG Intergenic
No off target data available for this crispr