ID: 954675479

View in Genome Browser
Species Human (GRCh38)
Location 3:52313171-52313193
Sequence CATCCTCCAGCTGCCCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954675479_954675485 -3 Left 954675479 3:52313171-52313193 CCACAGGGGGCAGCTGGAGGATG No data
Right 954675485 3:52313191-52313213 ATGGCTGGGGGCCCTGTTGATGG No data
954675479_954675488 22 Left 954675479 3:52313171-52313193 CCACAGGGGGCAGCTGGAGGATG No data
Right 954675488 3:52313216-52313238 AGTCCAGTTCTTCCATAAACAGG No data
954675479_954675489 23 Left 954675479 3:52313171-52313193 CCACAGGGGGCAGCTGGAGGATG No data
Right 954675489 3:52313217-52313239 GTCCAGTTCTTCCATAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954675479 Original CRISPR CATCCTCCAGCTGCCCCCTG TGG (reversed) Intergenic
No off target data available for this crispr