ID: 954675485

View in Genome Browser
Species Human (GRCh38)
Location 3:52313191-52313213
Sequence ATGGCTGGGGGCCCTGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954675479_954675485 -3 Left 954675479 3:52313171-52313193 CCACAGGGGGCAGCTGGAGGATG No data
Right 954675485 3:52313191-52313213 ATGGCTGGGGGCCCTGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954675485 Original CRISPR ATGGCTGGGGGCCCTGTTGA TGG Intergenic
No off target data available for this crispr