ID: 954676359

View in Genome Browser
Species Human (GRCh38)
Location 3:52317832-52317854
Sequence GACGCTAGGCCGTTGCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954676359_954676363 -8 Left 954676359 3:52317832-52317854 CCCCTTAGCAACGGCCTAGCGTC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 954676363 3:52317847-52317869 CTAGCGTCCCTCCCTAGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 57
954676359_954676371 21 Left 954676359 3:52317832-52317854 CCCCTTAGCAACGGCCTAGCGTC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 954676371 3:52317876-52317898 TGCATCCCCGCACTGCTCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 70
954676359_954676365 -6 Left 954676359 3:52317832-52317854 CCCCTTAGCAACGGCCTAGCGTC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 954676365 3:52317849-52317871 AGCGTCCCTCCCTAGAGACGGGG 0: 1
1: 0
2: 1
3: 8
4: 110
954676359_954676374 27 Left 954676359 3:52317832-52317854 CCCCTTAGCAACGGCCTAGCGTC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 954676374 3:52317882-52317904 CCCGCACTGCTCGGTGGAACCGG 0: 1
1: 0
2: 1
3: 4
4: 48
954676359_954676364 -7 Left 954676359 3:52317832-52317854 CCCCTTAGCAACGGCCTAGCGTC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 954676364 3:52317848-52317870 TAGCGTCCCTCCCTAGAGACGGG 0: 1
1: 0
2: 1
3: 1
4: 64
954676359_954676370 18 Left 954676359 3:52317832-52317854 CCCCTTAGCAACGGCCTAGCGTC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 954676370 3:52317873-52317895 TGATGCATCCCCGCACTGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954676359 Original CRISPR GACGCTAGGCCGTTGCTAAG GGG (reversed) Intronic
906238179 1:44224479-44224501 GACGCTAAGCCCTTGCTGTGTGG - Intronic
911044574 1:93617795-93617817 GACGCCAGGCTGGTGCTGAGTGG - Intronic
1072230395 10:93409554-93409576 AACGCCAGGCCGTTGCTACCTGG + Exonic
1072940653 10:99760632-99760654 GCCTCTAGGCCTTTGATAAGAGG + Intergenic
1085637544 11:78170143-78170165 GAGGCTAGGCCCTTCTTAAGAGG + Intergenic
1129116247 15:73367057-73367079 GGAGCTGGCCCGTTGCTAAGAGG + Intronic
1129319630 15:74767377-74767399 GAGGCTATGCCTTTCCTAAGAGG - Intergenic
1134862011 16:17568650-17568672 AAGGCTAGGCAGTTTCTAAGGGG - Intergenic
1138725891 16:59138982-59139004 GAGGAAAGGCCTTTGCTAAGGGG - Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1173566041 20:44039367-44039389 ATGGCTAGGCCATTGCTAAGTGG + Intronic
954676359 3:52317832-52317854 GACGCTAGGCCGTTGCTAAGGGG - Intronic
986941219 5:12952148-12952170 GATGCTAGGCCGTTAGTATGAGG - Intergenic
1019507097 7:1396980-1397002 GACGCTAGGCCCTGGCTAAATGG - Intergenic
1021698938 7:23299336-23299358 GACGCAAGGCTGCTGCTATGGGG + Exonic
1028045028 7:86107537-86107559 GACTCTAGGCCTTTGATAGGAGG - Intergenic
1040598325 8:48861211-48861233 GACCCTACGCCCTTGCTGAGCGG + Intergenic