ID: 954678350

View in Genome Browser
Species Human (GRCh38)
Location 3:52327701-52327723
Sequence CCCTCTCCACTGCTAGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954678350_954678354 -9 Left 954678350 3:52327701-52327723 CCCAGTCCTAGCAGTGGAGAGGG 0: 1
1: 0
2: 2
3: 22
4: 161
Right 954678354 3:52327715-52327737 TGGAGAGGGTCAGCCCCCAGTGG 0: 1
1: 0
2: 9
3: 34
4: 263
954678350_954678355 -4 Left 954678350 3:52327701-52327723 CCCAGTCCTAGCAGTGGAGAGGG 0: 1
1: 0
2: 2
3: 22
4: 161
Right 954678355 3:52327720-52327742 AGGGTCAGCCCCCAGTGGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 248
954678350_954678356 -3 Left 954678350 3:52327701-52327723 CCCAGTCCTAGCAGTGGAGAGGG 0: 1
1: 0
2: 2
3: 22
4: 161
Right 954678356 3:52327721-52327743 GGGTCAGCCCCCAGTGGAGAGGG 0: 1
1: 0
2: 1
3: 23
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954678350 Original CRISPR CCCTCTCCACTGCTAGGACT GGG (reversed) Intronic
900218338 1:1494290-1494312 CCCTCTCCTCTGCTGGGCCCTGG + Intronic
900836523 1:5009265-5009287 CCCTCTCTCCTCCTAGGACTTGG - Intergenic
901117270 1:6857194-6857216 CCAGCTCCACTGCTGGGCCTTGG - Intronic
901839003 1:11942339-11942361 CCCTCACCATGGCTGGGACTGGG - Intronic
902634809 1:17728318-17728340 CCCTCTCCACTCCAAGCAGTGGG + Intergenic
902820101 1:18938444-18938466 CCCTCTCCCATGCTGGGACTGGG + Intronic
903168187 1:21535793-21535815 CCCACTCCACTCCAATGACTAGG + Intronic
903319916 1:22536752-22536774 CCATCCCTGCTGCTAGGACTTGG - Intergenic
905561284 1:38929294-38929316 CCATCCCCACTGCTACGACGAGG + Intronic
906607581 1:47182667-47182689 CCCTCTCCCCTGCTCCTACTAGG + Intergenic
909215758 1:72886334-72886356 ACTTCACCATTGCTAGGACTTGG + Intergenic
915013027 1:152707800-152707822 CTCTCTCCACAGTTAGGACTGGG + Intergenic
915369797 1:155339224-155339246 TCAGCTCCACTTCTAGGACTGGG - Intronic
918296176 1:183159523-183159545 TACTCTCTACTGCTAGGACTTGG + Intergenic
919597423 1:199581184-199581206 CCCTCTCCACTGATATGGTTTGG + Intergenic
919659959 1:200234591-200234613 CCCTCTCGAATCCTAGGATTTGG + Intergenic
919986480 1:202679268-202679290 CCCTCTCTTCTCCTAGGGCTTGG + Intronic
924642523 1:245848013-245848035 CACACTCCACTCCTGGGACTAGG - Intronic
1062768806 10:84039-84061 CCCTCTCCACTGCTTGGTCCTGG - Intergenic
1063279212 10:4606990-4607012 CCCTCTTCCCTGCTAGCAGTGGG - Intergenic
1066383717 10:34923084-34923106 CCATCTCCACTGGTAAGACCAGG - Intergenic
1067087849 10:43252331-43252353 ACCTCTCCACAGCCAGGACTAGG + Intronic
1069330131 10:67282284-67282306 CTCTCTCCACAGCTAGGCTTAGG - Intronic
1073256049 10:102152037-102152059 CCCGCGCCCCTGCTGGGACTCGG - Intergenic
1076032814 10:127173988-127174010 GCCTCTCCACTGCTGGAGCTGGG + Intronic
1076734937 10:132454612-132454634 CCCTCTCCCCTGAGAGGACTGGG - Intergenic
1078938632 11:15976005-15976027 ATCTCTCCACTCCCAGGACTAGG - Intronic
1082877674 11:58004396-58004418 TCCTCTCCACTTCCAGGATTTGG - Intergenic
1083600500 11:63944572-63944594 CCCTCTGCAGTGCTAGGACGAGG - Intronic
1083643113 11:64156328-64156350 ACCTCCCCACTGCGAGGCCTTGG + Intronic
1084186256 11:67473626-67473648 ACCTCTCCAGTGCTAGGAAGGGG - Intergenic
1088626621 11:111734507-111734529 CCCTCTCCACTGTGGGGCCTAGG - Intronic
1090158789 11:124469648-124469670 TGCTCCCGACTGCTAGGACTGGG - Intergenic
1090421899 11:126580993-126581015 CCCTTTCCAGAGCTAGGACCTGG - Intronic
1091741737 12:2964225-2964247 CGCTCGCCCCTGCCAGGACTTGG + Intronic
1092190076 12:6512798-6512820 CCATCTCCACTGCCACGCCTTGG - Intronic
1095825987 12:46531015-46531037 CCCAGTCCACAGCCAGGACTTGG - Intergenic
1095925924 12:47579251-47579273 CCCTTACCACTCCTAGGCCTAGG - Intergenic
1096214158 12:49790385-49790407 CCCTCTTCTCTGCTTGAACTTGG - Intergenic
1096229593 12:49889639-49889661 CCCTCTCTTCTGCCAGGACCTGG + Intronic
1096809235 12:54159165-54159187 CCCTCTCCTCCGCTGGGGCTGGG - Intergenic
1098239584 12:68453228-68453250 CCCTCTCCACTCCTGGCACATGG - Intergenic
1102985379 12:117273410-117273432 CCCTCTCCAAGGCTGGGACTAGG + Intronic
1104302931 12:127581923-127581945 CCATGCCCATTGCTAGGACTGGG + Intergenic
1105834271 13:24194654-24194676 CGCTTTCCACTGGAAGGACTAGG + Intronic
1112323878 13:98430546-98430568 GCCCCTCCTCTGCTAGGTCTGGG - Intronic
1115355167 14:32439259-32439281 TCCTCTCCACAGCTGGGATTTGG + Intronic
1116003293 14:39267005-39267027 GCCTCTCCACTACCAGGGCTGGG + Intronic
1116454976 14:45109285-45109307 CCCTCTCCACTCCTAGCACTAGG + Intronic
1116779564 14:49221671-49221693 CCCTCTCCACTCCCAGGAATCGG + Intergenic
1122128240 14:99590707-99590729 ACCTGTCCCCTGCTAGGACTTGG - Intronic
1122409123 14:101517137-101517159 CCCACTCCACTGCTGGGAGTTGG + Intergenic
1124292151 15:28463128-28463150 CCTTTTCCACTGCCAGTACTTGG - Intergenic
1124806303 15:32886791-32886813 CCCTCTCCACTGGTAGAATTAGG - Intronic
1126110966 15:45174497-45174519 CCCTCTCCCCTGCTTGGGCAAGG - Intronic
1126302470 15:47213536-47213558 CCCTCTCCTCCACTATGACTAGG + Intronic
1129191849 15:73942020-73942042 CTCTCTCCCCTGCAAGGCCTGGG - Intronic
1132457662 16:33063-33085 CCCTCTCCACTGCCTGGACCTGG - Intergenic
1134802356 16:17096979-17097001 CCCTCTCCACTCCAATTACTCGG - Intergenic
1135164725 16:20129117-20129139 CCCGCTCCACTGCTGGCACCAGG - Intergenic
1136288103 16:29255686-29255708 CCCTCTCCTCTGCTCTGACAGGG - Intergenic
1137868915 16:51930762-51930784 CCCTCTCCAAGGCTCTGACTTGG + Intergenic
1137878994 16:52026757-52026779 TCCTCTCCACTCCTTGGACCAGG - Intronic
1138659417 16:58508712-58508734 CACTCACAACTGCTAGGAGTGGG - Intronic
1140330759 16:74054599-74054621 CTCTCTCTACTCCTAGGCCTTGG - Intergenic
1140485203 16:75288087-75288109 CCCTCTCCCCTGCAAAGAGTGGG + Intergenic
1140888087 16:79261896-79261918 CCCTCTCCACTGTCAGGAGGAGG - Intergenic
1141386615 16:83627331-83627353 CCCACTCCACTCCTAGAAGTGGG - Intronic
1142093772 16:88228453-88228475 CCCTCTCCTCTGCTCTGACAGGG - Intergenic
1143996769 17:11013210-11013232 CCATCTCCACTGCTACTGCTAGG + Intergenic
1147769206 17:42856259-42856281 TCTTCTCCCCTGCTAGGATTTGG + Exonic
1147771941 17:42874078-42874100 TCTTCTCCCCTGCTAGGACTTGG + Intergenic
1149589338 17:57817045-57817067 CCAACTCCAGGGCTAGGACTAGG - Intergenic
1149597475 17:57872818-57872840 CCCTCTCCACTCCCAGGCTTGGG + Exonic
1151017677 17:70576402-70576424 CACTCTTCACTGCTTGGAATGGG - Intergenic
1151272814 17:73010002-73010024 CCCTCTCCACTCCAAGGTTTCGG + Intronic
1151901145 17:77016126-77016148 TCCACTCCACTGCCAGGAATGGG - Intergenic
1152082621 17:78197773-78197795 CCCCCTCCACTGCTTGTCCTGGG - Intronic
1152961690 18:83872-83894 CCCTCTCCACTGCCTGGTCCTGG - Intergenic
1153445518 18:5168238-5168260 CCCTCTGCTCTGCTATAACTAGG - Intronic
1157294310 18:46431572-46431594 CCCTCTCCTCTTCTACTACTTGG - Intronic
1160872412 19:1283307-1283329 TGCTCTGCACTGCTGGGACTGGG - Intergenic
1162323059 19:9981047-9981069 CCCCCTACCCTGCTGGGACTTGG - Intronic
1162959944 19:14119696-14119718 ACCTGTCCTCTGCTAGGACCAGG - Exonic
1167103589 19:47418555-47418577 GCCTCTCCAGGGCTAGGAGTGGG - Intronic
1167126931 19:47555857-47555879 GGCTCTCCACTGCCAGGTCTTGG + Intergenic
1167505775 19:49870289-49870311 CCCTCTCCCCTTCTTGGCCTAGG + Intronic
925214703 2:2084496-2084518 CCCTCTCCACTCCTAGCCCAGGG - Intronic
925675842 2:6360301-6360323 GCATCTCCACTGCTGGGACAGGG + Intergenic
926277374 2:11414668-11414690 CCTTCTCCTCTCCTAGGTCTTGG + Intergenic
927864242 2:26578590-26578612 CCATCACCACCTCTAGGACTCGG + Intronic
929929325 2:46239795-46239817 GCCTCTCAGATGCTAGGACTTGG - Intergenic
931515875 2:63050540-63050562 CCCCCTCCGCGGCCAGGACTCGG + Intronic
933783423 2:85818240-85818262 TCCTCTCTACTGCTGGGATTGGG + Intergenic
933892538 2:86785128-86785150 CCCTCTGCAATGCAAGGGCTGGG + Exonic
935839115 2:107089616-107089638 CCCTGTCCACTGCTCTCACTAGG - Intergenic
937429457 2:121826095-121826117 CTCTCTCCACTTCTAGCACAGGG + Intergenic
939700643 2:145386679-145386701 GCCTCTCCACTGGTAGGGCCTGG - Intergenic
944609802 2:201391029-201391051 CCCTCTCAGCAGGTAGGACTAGG - Intronic
944878135 2:203983762-203983784 CCCTCTGCACTACTAGCCCTAGG + Intergenic
945908961 2:215624806-215624828 CTCTCTCCACTGCTCGGTCTGGG + Intergenic
947767950 2:232649403-232649425 CCTTATCCTCTGATAGGACTGGG + Intronic
948912592 2:241011888-241011910 CCCTGTCCCCTGCCAGGACAGGG - Intronic
1169911188 20:10648716-10648738 CCTTCTCCTCTTCTAGGATTTGG - Exonic
1169926455 20:10789587-10789609 CCCTTTCCAGGGCTAGAACTTGG + Intergenic
1170838796 20:19907336-19907358 CCCTCTCCAGGGCTATGATTGGG - Intronic
1176377372 21:6093163-6093185 CCATCTCCACTGCATGGTCTGGG + Intergenic
1178532846 21:33389689-33389711 CCCTCCCCACTGCGTGAACTGGG + Intergenic
1178933230 21:36837849-36837871 CCCTCTCCGCTGTAAGAACTTGG - Intronic
1179746102 21:43445081-43445103 CCATCTCCACTGCATGGTCTGGG - Intergenic
1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG + Intronic
1181834395 22:25591018-25591040 CCCTCCCCACTGCTAGGTTAAGG + Intronic
1182773351 22:32811962-32811984 CCCTATCCACTGCCAGGGCTAGG + Intronic
1183224019 22:36536912-36536934 CCCACTCCACAGCTAGAGCTGGG - Intergenic
1183519774 22:38290169-38290191 CCCTCTCCACTGCTGACCCTGGG - Intergenic
1184234598 22:43176288-43176310 CCCCCCCCACTGCTTGGGCTGGG - Intronic
1184553378 22:45217933-45217955 CCCTCTCCCCTGCTAGTCCCTGG - Intronic
1185234784 22:49705397-49705419 CTCTCTCCACTGCCTGGGCTAGG - Intergenic
952804194 3:37331344-37331366 GACTTTCAACTGCTAGGACTAGG + Intronic
954678350 3:52327701-52327723 CCCTCTCCACTGCTAGGACTGGG - Intronic
959431132 3:106256484-106256506 CCCTCTCCACTCCTGGGGGTTGG + Intergenic
959539236 3:107521919-107521941 ACCTCTCCAATGCTCAGACTTGG - Intergenic
959991161 3:112633575-112633597 CCCTCTCCTCTCCTCTGACTAGG - Intronic
960836918 3:121916284-121916306 CCCTCTTCTCTTCCAGGACTGGG - Intronic
961202936 3:125058672-125058694 ACCTCTCCACAGGTAGGAGTGGG + Intergenic
961366346 3:126402194-126402216 CCCTCACCACCCCCAGGACTGGG - Intronic
962411275 3:135143544-135143566 GCCTCTCCACTGCTAGTGTTTGG + Intronic
962771653 3:138616074-138616096 CCATCTCCACTGCCAGTCCTGGG - Intronic
964288038 3:155142397-155142419 CCATGTACACTGCTAGGACATGG + Intronic
966098745 3:176240884-176240906 CTGTCTCCACTGCTACCACTGGG + Intergenic
968844248 4:3031127-3031149 TCCTCCCCACTGCAAGGACTTGG - Intronic
969329461 4:6465089-6465111 CCCTCTTCCTTGCTGGGACTTGG + Intronic
970209447 4:13693719-13693741 ACCTCTCCACTGCTAGGATTGGG + Intergenic
984064605 4:175032845-175032867 CCCACTCCAGTGCTGGCACTTGG - Intergenic
984878857 4:184392873-184392895 ATCTCTCCACTCCTCGGACTGGG + Intronic
985163710 4:187070339-187070361 CCCTCACCACGACTATGACTAGG + Intergenic
985773167 5:1825525-1825547 CCCTCTCCCCTGCCAGTGCTGGG + Intergenic
986035568 5:3933762-3933784 CCTCCTCCACTGCTTGGTCTTGG + Intergenic
986829026 5:11555254-11555276 CCTTGTCAACTGCTAGAACTAGG - Intronic
990607165 5:57422786-57422808 CCATCCTCACTGCTTGGACTGGG - Intergenic
992430730 5:76709023-76709045 CCCTTTCCAATGCTAGCAGTAGG - Intergenic
992766134 5:80002335-80002357 CAGTCTCCAATGCTAGGGCTAGG - Intronic
994815725 5:104585337-104585359 CCCTTTCCATTGTTGGGACTAGG - Intergenic
995441749 5:112199876-112199898 CATTCTCTATTGCTAGGACTCGG + Intronic
999450065 5:151671423-151671445 CCCTCTTTCCTGCTGGGACTAGG + Intronic
1000036437 5:157452052-157452074 CCCCCACCTATGCTAGGACTTGG - Intronic
1000658802 5:163914941-163914963 CCCACTCCATTGCTAGGCTTTGG + Intergenic
1006598206 6:35208940-35208962 CTCTCTCCACTGCTGGGAGAGGG - Intergenic
1007116654 6:39347907-39347929 GTCTCTCCACTGCTAGGAAATGG - Intronic
1007449165 6:41930237-41930259 CCCTGTACACTTCTAGGACCCGG - Exonic
1009688301 6:66991794-66991816 ACCTCTCCACTGATAAGATTTGG + Intergenic
1012624865 6:101393243-101393265 ACTTCTCCACTGCCAGGGCTTGG - Intergenic
1028985569 7:97006184-97006206 CCCTCTGCACTGCCTGCACTCGG + Exonic
1029312805 7:99683296-99683318 TTCTCTCCACTGATAGGGCTAGG - Intergenic
1029320627 7:99756325-99756347 TTCTCTCCACTGATAGGGCTAGG - Intergenic
1035185192 7:157120971-157120993 CCCTCTCGACCGCTGGGTCTGGG - Intergenic
1035644032 8:1204869-1204891 CCCTCTCCAGAGCCTGGACTTGG + Intergenic
1035678809 8:1472549-1472571 GCGTCTCCACTGCTGGCACTCGG - Intergenic
1036734573 8:11299493-11299515 CCTACTGCACTGCTAGGATTTGG + Intronic
1037377874 8:18251283-18251305 ACCTCTCTACTGCTAGGTTTGGG - Intergenic
1037754009 8:21699930-21699952 TCCTCTCCCCTGCTAGGCCAGGG - Intronic
1038067821 8:23982134-23982156 CCCAGTCCACTGCTAGAAATTGG + Intergenic
1038206813 8:25475038-25475060 ACCTTTCCACTGCTAGGATTGGG + Intronic
1038919793 8:32069880-32069902 CACGCCACACTGCTAGGACTTGG - Intronic
1039217283 8:35286477-35286499 ACCTCTCCACTGCTAGGGTCAGG - Intronic
1039484633 8:37900826-37900848 CCCTCTGCAGAGCTGGGACTGGG + Intergenic
1041248247 8:55909295-55909317 CTCTCCCCAATGCCAGGACTGGG - Intronic
1041726890 8:61026425-61026447 CCCTCACCTCAGCTAGGGCTGGG - Intergenic
1045900293 8:107270565-107270587 CCCTTTCCACTGAAAGAACTGGG + Intronic
1047334011 8:123919143-123919165 GCCTCTCCACTGCTGAGACTTGG - Intronic
1047529864 8:125664928-125664950 CCCTCTCCCCAGCTGTGACTGGG - Intergenic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1057051026 9:91924291-91924313 CTCTCTCCACCGCAGGGACTAGG - Intronic
1058652710 9:107191437-107191459 ACTTCTGCACTGCAAGGACTGGG + Intergenic
1059716531 9:116918249-116918271 CCCTCTACTCTGCTAGCTCTGGG - Intronic
1060434703 9:123583474-123583496 CCCTTTTCACTCCTGGGACTTGG - Intronic
1060914359 9:127377451-127377473 CTCTCTCCACCGCTAAGACTTGG - Intronic
1061179024 9:129013247-129013269 ACCTTTCCAGAGCTAGGACTTGG - Intronic
1062522514 9:136964128-136964150 CCCTCTCCCCTGCCAGGCCTGGG - Intergenic
1062736461 9:138140248-138140270 CCCTCTCCACTGCCTGGTCCTGG + Intergenic
1187207495 X:17197049-17197071 CTCTCTCCACTGCTGTTACTTGG - Intergenic
1187317219 X:18207064-18207086 CCCCCTGCACTGCTAGGCCAGGG - Intronic
1189312053 X:40026149-40026171 CCCACCCCACTGCTTGGGCTTGG - Intergenic
1197708318 X:129649437-129649459 CCCCATCCACTGGGAGGACTTGG - Intronic
1200398699 X:156006337-156006359 CCCTCTCCACTGCCTGGTCCTGG + Intronic
1201489402 Y:14524611-14524633 CCCTCCCCACTGCCACGGCTGGG + Intronic