ID: 954680737

View in Genome Browser
Species Human (GRCh38)
Location 3:52344631-52344653
Sequence GCAGGTGCCTGAGCGAGGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 314}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954680722_954680737 26 Left 954680722 3:52344582-52344604 CCAAGCCCGAGACCTTCTCCTAC 0: 1
1: 0
2: 0
3: 10
4: 164
Right 954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG 0: 1
1: 0
2: 5
3: 26
4: 314
954680730_954680737 -1 Left 954680730 3:52344609-52344631 CCCTCCCCAAGAAGGAGGAGGAG 0: 1
1: 0
2: 5
3: 49
4: 497
Right 954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG 0: 1
1: 0
2: 5
3: 26
4: 314
954680731_954680737 -2 Left 954680731 3:52344610-52344632 CCTCCCCAAGAAGGAGGAGGAGC 0: 1
1: 0
2: 0
3: 29
4: 293
Right 954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG 0: 1
1: 0
2: 5
3: 26
4: 314
954680724_954680737 20 Left 954680724 3:52344588-52344610 CCGAGACCTTCTCCTACGTCACC 0: 1
1: 0
2: 0
3: 14
4: 152
Right 954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG 0: 1
1: 0
2: 5
3: 26
4: 314
954680726_954680737 8 Left 954680726 3:52344600-52344622 CCTACGTCACCCTCCCCAAGAAG 0: 1
1: 0
2: 4
3: 93
4: 740
Right 954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG 0: 1
1: 0
2: 5
3: 26
4: 314
954680732_954680737 -5 Left 954680732 3:52344613-52344635 CCCCAAGAAGGAGGAGGAGCAGG 0: 1
1: 1
2: 10
3: 153
4: 798
Right 954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG 0: 1
1: 0
2: 5
3: 26
4: 314
954680734_954680737 -6 Left 954680734 3:52344614-52344636 CCCAAGAAGGAGGAGGAGCAGGT 0: 1
1: 0
2: 5
3: 79
4: 545
Right 954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG 0: 1
1: 0
2: 5
3: 26
4: 314
954680725_954680737 14 Left 954680725 3:52344594-52344616 CCTTCTCCTACGTCACCCTCCCC 0: 1
1: 0
2: 1
3: 59
4: 1022
Right 954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG 0: 1
1: 0
2: 5
3: 26
4: 314
954680723_954680737 21 Left 954680723 3:52344587-52344609 CCCGAGACCTTCTCCTACGTCAC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG 0: 1
1: 0
2: 5
3: 26
4: 314
954680735_954680737 -7 Left 954680735 3:52344615-52344637 CCAAGAAGGAGGAGGAGCAGGTG 0: 1
1: 0
2: 11
3: 120
4: 798
Right 954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG 0: 1
1: 0
2: 5
3: 26
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954680737 Original CRISPR GCAGGTGCCTGAGCGAGGTG AGG Exonic
900137203 1:1122605-1122627 GCTGGCGACTCAGCGAGGTGGGG + Intergenic
900147880 1:1166311-1166333 GCAGGGCCCTGAGCAAGGAGGGG + Intergenic
900402463 1:2478164-2478186 GCAGGTGGCCGAGCAGGGTGGGG + Intronic
900479107 1:2889690-2889712 GCCGGGGGCTGAGGGAGGTGGGG + Intergenic
900801063 1:4737340-4737362 GCATTTCCCTGAGAGAGGTGAGG - Intronic
901699681 1:11038572-11038594 GCAGGTGCTGGAGGGAGGAGAGG - Intronic
901775874 1:11560185-11560207 CCAGGTCCCTGGGGGAGGTGAGG - Intergenic
902714548 1:18263382-18263404 GCAGGTGCCTAGTAGAGGTGGGG - Intronic
903008253 1:20312604-20312626 GCAGGTGTGTGAGCCTGGTGTGG - Intronic
903183792 1:21618493-21618515 GCAGGGGACTCAGCGAGATGAGG - Intronic
903742897 1:25568550-25568572 GGAGGTGCCTGAGGGTGGGGTGG + Exonic
904390448 1:30181879-30181901 GCAAGTGACTGAGCCTGGTGAGG + Intergenic
905473831 1:38212046-38212068 GCAGAGGTCTGAGGGAGGTGAGG - Intergenic
905792075 1:40795109-40795131 GCTGGTGCCTCAGAGAGGTTGGG - Intronic
905857940 1:41327224-41327246 ACAGGAGCCTGAGAGAGGTAGGG + Intergenic
906236319 1:44213511-44213533 GCAGCTGCCGGACCCAGGTGCGG + Exonic
906319449 1:44807306-44807328 TCAGGTGCCTGAGGGAGTTTCGG - Intergenic
906797600 1:48710425-48710447 GCAGGAGCCAGAGCGTGGGGTGG + Intronic
909340743 1:74528278-74528300 GCTGGAGCCTGAGCAGGGTGAGG + Intronic
910597323 1:88993287-88993309 GAAGGTGCCTGAGAGAGGGCAGG + Intergenic
912932091 1:113973165-113973187 GCAGGGGCCGGGGCAAGGTGTGG - Exonic
915333165 1:155126118-155126140 GCAGGTGCCCGAGGGAGAGGGGG + Intergenic
917591472 1:176480769-176480791 GCAAGAGCCTGAGGGAGGGGTGG - Intronic
918549639 1:185727414-185727436 GCAGCTGCCTGTGAGAGGAGCGG + Intergenic
919803761 1:201368722-201368744 CCAAGTGCCTGAGTGAGATGGGG - Intronic
920336178 1:205246900-205246922 GCAGGGGCCTGGGGGAAGTGGGG + Intronic
920534495 1:206728888-206728910 TAAGGTGCCTGAGTGAGGAGTGG - Intronic
920631437 1:207656665-207656687 GCAGGAGCAGGAGCAAGGTGGGG + Intronic
921017620 1:211207090-211207112 GCAGCTGCTTGGGCGCGGTGCGG + Intergenic
921133889 1:212243087-212243109 GCAGGGGTCTGGGGGAGGTGTGG - Intergenic
922423078 1:225472150-225472172 CCAGGAGTCTGAGCTAGGTGAGG + Intergenic
1062830494 10:602275-602297 ACAGGTGCCTGTGCAAGTTGGGG - Intronic
1066307171 10:34156728-34156750 GCAGGGGCCTGGGCGAGCTCTGG - Intronic
1067529219 10:47058451-47058473 GCAGTTGGCTGAGCAAAGTGTGG + Intergenic
1071515376 10:86293356-86293378 GCAGGGGCCTGAGCAGTGTGGGG - Intronic
1072737418 10:97888592-97888614 GCAGGTGTCTGAGCTAGGACTGG + Intronic
1073075678 10:100824765-100824787 GCAGCTGCCTAATCTAGGTGGGG + Intronic
1073190953 10:101650419-101650441 GCAGGGCTCTGAGGGAGGTGGGG - Intronic
1073216523 10:101839802-101839824 GCAGGTGCCGGAGCCCGCTGGGG - Intronic
1076686240 10:132199666-132199688 GCAGGTCCCTGGGCAGGGTGGGG + Intronic
1076765986 10:132633484-132633506 GCAGGTGCCCAAGCGTGGAGTGG + Intronic
1076775088 10:132690922-132690944 GCAGGTGCGTGAGCTAGGCCGGG + Intronic
1077080309 11:722048-722070 GCAGGTGCCGGGGCGGGGCGGGG - Intronic
1077399717 11:2348238-2348260 GCAGGAGCAAGAGAGAGGTGGGG - Intergenic
1080943130 11:36941610-36941632 ACAGGTGCCTGAGAGAAGAGAGG - Intergenic
1081639020 11:44740202-44740224 GCAGGGGCCTGGGCTAGGTAGGG + Intronic
1081724531 11:45318762-45318784 CCAGCTGCCTGAGGGAGGAGTGG + Intergenic
1082284186 11:50301737-50301759 GCCGCTGCCTGAGTGAGGTGAGG - Intergenic
1083253781 11:61484366-61484388 GCAGCTGTCTGAGGGAGGAGTGG + Intronic
1083780456 11:64914876-64914898 GCAGGTGCTTGGGGGTGGTGAGG + Intronic
1084004607 11:66316364-66316386 GAAGCAGCCTGAGGGAGGTGTGG - Exonic
1084485261 11:69444308-69444330 GCATGTACCTCAGGGAGGTGTGG + Intergenic
1086237117 11:84644825-84644847 GTGGGTGCCTGAGCGCTGTGTGG + Intronic
1087173034 11:95069856-95069878 GCAGGTGGCGAAGGGAGGTGAGG + Exonic
1087396859 11:97610543-97610565 CCAGGTGCCTGAGCTAGTAGGGG + Intergenic
1088890365 11:114039339-114039361 GCAGGTGACAGGGCCAGGTGGGG - Intergenic
1089130107 11:116205576-116205598 GAAGGTGGCAGAGGGAGGTGAGG - Intergenic
1091399247 12:172525-172547 GCAGGGCCCTGAGCTAGCTGAGG - Intronic
1091405332 12:205216-205238 GCAGGTGCCAGAGGGAGGCCAGG + Intronic
1092275575 12:7058505-7058527 GCAGGTCCCTGAGCTAGGAGGGG - Intronic
1094057133 12:26279159-26279181 GCTGGTGACTGTGCAAGGTGTGG + Intronic
1095638039 12:44454878-44454900 GCTGGTGGCTGAGCTTGGTGAGG - Intergenic
1096159903 12:49367571-49367593 GCGGGGGCCTGGGCTAGGTGAGG + Exonic
1096402784 12:51321202-51321224 GCAGCAGCCTGAGTGAGGTTAGG + Intronic
1096478213 12:51921469-51921491 TCAGCTGCCTGAGAGAGCTGGGG + Intronic
1096620252 12:52860095-52860117 GCTGGTGCCTGAGAGAGGAAGGG + Intergenic
1097719311 12:63002962-63002984 GCAGGAGCTTGAGCGGGGTAGGG - Intergenic
1100407834 12:94286385-94286407 GTAGGTGGCTGAGGGTGGTGGGG - Intronic
1101197742 12:102402745-102402767 GAAGATGCCTGAGTGAGGTTTGG - Intronic
1101455291 12:104825253-104825275 CCAGGTGCCTGAGCTGGGAGGGG - Intronic
1101466815 12:104958012-104958034 TCAGGTGCGGGAGGGAGGTGGGG - Intronic
1101475080 12:105038055-105038077 ATAGGTGCCTGGGCCAGGTGAGG - Intronic
1102682892 12:114702557-114702579 GCAAGTGCAGGGGCGAGGTGGGG + Intergenic
1104170525 12:126276031-126276053 CCTGGTGCCTGAGTGAGATGGGG - Intergenic
1104296828 12:127523492-127523514 GCTGGTGCCAGAGGGAGTTGAGG - Intergenic
1105015888 12:132786662-132786684 GCATGTGCCCGGGGGAGGTGCGG - Intronic
1105474580 13:20719276-20719298 GCAGGTGTCTGAGCGTGGGCAGG - Intronic
1107003966 13:35585718-35585740 GCAGGTACATGAGGGAGATGAGG - Intronic
1110132394 13:72023359-72023381 GCAGGTGTCTGGTCAAGGTGGGG - Intergenic
1110175124 13:72547105-72547127 GCAGGTGGCAGAGTGAGGTATGG + Intergenic
1113766982 13:112887904-112887926 GCAGGTGGCTGAGCAGGGAGAGG - Intergenic
1113792421 13:113035982-113036004 GCAGGGGCCTGAGGGATGTTTGG + Intronic
1113946839 13:114049050-114049072 GCAGGTGCCAGAAGGAAGTGGGG - Intronic
1118324997 14:64774606-64774628 GGAGGTGCCCGAGGGAGGAGGGG + Intronic
1120159657 14:81131678-81131700 GGAGGTGTCTGAAGGAGGTGAGG - Intronic
1121743425 14:96269463-96269485 GCAGGGGCCTGAGCTGGGGGTGG - Intergenic
1123779275 15:23609280-23609302 GCAGATACCTTAGCCAGGTGTGG - Intronic
1125556859 15:40592955-40592977 GCAGGTGCTTCAGCAAGGTTTGG - Intergenic
1125999412 15:44195130-44195152 GCAGGTGCCTGGGGTCGGTGCGG - Exonic
1126152899 15:45539020-45539042 GCAAGTGCCTGAGCTAAGCGTGG - Intergenic
1127400898 15:58585033-58585055 GAAGGTGTCTGAGAGAGGTGAGG - Intergenic
1128041087 15:64574026-64574048 GCAGGGGCAAGAGCGGGGTGTGG - Intronic
1128882859 15:71259505-71259527 GCAGATGCCTTAGAGAAGTGAGG + Intronic
1129246703 15:74283319-74283341 GCAGGAGACAGAGGGAGGTGGGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1130520398 15:84657265-84657287 GCTGGTCCCTCAGGGAGGTGTGG + Exonic
1131443121 15:92473801-92473823 GCTGGCGGCTGAGCCAGGTGTGG - Intronic
1131804796 15:96110010-96110032 GCTGGTTCTTCAGCGAGGTGGGG + Intergenic
1132517298 16:371693-371715 ACAGGTGCCTGTGCGAGGGTGGG - Exonic
1132638305 16:964856-964878 GCAGCTGCTTCGGCGAGGTGGGG - Intronic
1132996969 16:2828559-2828581 CCAGGTGCCTGCGCCAGGGGTGG - Intergenic
1133053411 16:3132013-3132035 GCAGGAGCCGGACCAAGGTGAGG - Intronic
1133056868 16:3149769-3149791 GCCGGCGCCGGAGCGAGCTGCGG - Exonic
1134214470 16:12306340-12306362 GCAGGTGCCTGGCCGAGGGAGGG + Intronic
1136153745 16:28368468-28368490 GCAGGTGCTGGAGGGAGCTGGGG - Intergenic
1136209347 16:28746802-28746824 GCAGGTGCTGGAGGGAGCTGGGG + Intergenic
1137975945 16:53032332-53032354 GCAGGTGCCATTGGGAGGTGGGG - Intergenic
1139938811 16:70590405-70590427 GGAGGTGCCTGTGCGAGGTGGGG + Intronic
1140328082 16:74025304-74025326 GCAGGGGGCTGGGGGAGGTGAGG - Intergenic
1141004595 16:80340237-80340259 TCCAGTGCCTGAGCAAGGTGGGG - Intergenic
1141391571 16:83668915-83668937 GAAGCTGCCTGAGCCTGGTGTGG - Intronic
1141605614 16:85151848-85151870 GCAGGCCACTGAGGGAGGTGGGG - Intergenic
1141693613 16:85610056-85610078 GCAGGTACCTGAGGCAGGTGAGG + Intergenic
1142095055 16:88234954-88234976 GCAGGCGGCCGAGCGGGGTGGGG + Intergenic
1142317627 16:89358209-89358231 GCTGATGCCAGAGTGAGGTGTGG - Intronic
1142361894 16:89631243-89631265 CCAGGTGCCCCAGCGAGGTCGGG - Intronic
1142393392 16:89816772-89816794 GGAGGCGCCTGCGCGCGGTGAGG + Intergenic
1142752247 17:1995987-1996009 GTAGGTTCCTTGGCGAGGTGAGG + Intronic
1142864039 17:2779676-2779698 GCAGGTGCTTGAAGGAGGAGTGG + Intronic
1144348013 17:14367454-14367476 GCAGGTGGCTTAGAGAGGTCAGG + Intergenic
1144623147 17:16831127-16831149 CCTGGTTCCTGAGCAAGGTGGGG - Intergenic
1144883284 17:18441589-18441611 CCTGGTTCCTGAGCAAGGTGGGG + Intergenic
1145148944 17:20502797-20502819 CCTGGTTCCTGAGCAAGGTGGGG - Intergenic
1145233013 17:21188668-21188690 GCAGGTGACTGAGTGCGCTGGGG - Intronic
1147577469 17:41611063-41611085 CCTGGTTCCTGAGCAAGGTGGGG - Exonic
1147762311 17:42806976-42806998 GCAGGTGACTGAGCCTGGTCAGG + Intronic
1147996442 17:44362693-44362715 GCAGGTGGGTGTGTGAGGTGGGG - Intronic
1148674269 17:49435927-49435949 GCAGGTACCCGAGAGACGTGTGG - Intronic
1148713554 17:49699431-49699453 GAAGGTGTCTGGGCAAGGTGAGG - Intergenic
1149076152 17:52597727-52597749 TCAGGTGCCTGAGGGAGCAGGGG - Intergenic
1149295966 17:55263291-55263313 GAAGGTGCCTGAGCTGGGCGTGG - Intergenic
1151473710 17:74333228-74333250 GCAGGTGGCTAAGCGGGGAGAGG - Intronic
1151659320 17:75510247-75510269 GCAGGTGGCTGAGAGAAGAGGGG - Intronic
1152241531 17:79163749-79163771 CCAGGTGCCTGAGGGAGGTGGGG - Intronic
1154016906 18:10626963-10626985 GCATGTGCCTGTGAGAGGCGTGG + Intergenic
1154188601 18:12208681-12208703 GCATGTGCCTGTGAGAGGCGTGG - Intergenic
1154409455 18:14129546-14129568 CCAGGTGTCTGAGGGAAGTGAGG - Intronic
1155392478 18:25351079-25351101 GCCGGAGCCGGAGCGAGGAGCGG - Intronic
1156251161 18:35353557-35353579 GCAGGTGCAAGAGAGAGGTGGGG - Intergenic
1157514543 18:48301511-48301533 GCAGGGGGCTGAGGGAGGAGTGG + Intronic
1157596331 18:48866238-48866260 GGAGGTGCCTTTGGGAGGTGAGG - Intergenic
1159260344 18:66005291-66005313 GCAGGTGCCTGAGCCAGCAGTGG - Intergenic
1159893454 18:73974338-73974360 GTTGGTGCCTGAGCGGGGTGGGG + Intergenic
1160028182 18:75236166-75236188 GCAGGTGCCTAAGGGTGCTGGGG + Intronic
1160724207 19:610478-610500 GCCGGTCCCTGAGGGAGGCGAGG + Intronic
1160806925 19:996008-996030 GCTGGTGCCAGGGCGGGGTGAGG + Intronic
1161230398 19:3172189-3172211 GTAGGTGCCTGAGTCATGTGAGG + Intergenic
1162301770 19:9848692-9848714 GCAGGTGTCTTAGTGGGGTGGGG + Intronic
1162514278 19:11138778-11138800 GCGGCTGCCAGAGGGAGGTGGGG + Intronic
1162738792 19:12761972-12761994 GCAGATACCTGAAGGAGGTGAGG - Intergenic
1164402078 19:27909627-27909649 GCAGGTGCCCGAGCCAGGCGTGG - Intergenic
1164481090 19:28611478-28611500 TCAGGTGCCTGAGGGAGCAGGGG - Intergenic
1165137499 19:33678947-33678969 GCAGGTGCTTGGGCAATGTGTGG - Intronic
1165138973 19:33687969-33687991 GTCAGTGCCTGAGGGAGGTGAGG - Intronic
1165306390 19:35005360-35005382 GCAGAGACCTGAGGGAGGTGGGG + Intronic
1166502931 19:43354389-43354411 GCAGGTGCCTGCGGGAGGGTCGG + Exonic
1166546037 19:43635437-43635459 GCAGGTTTCTGAGGGAGGAGGGG - Intronic
1166819241 19:45566762-45566784 GCAGCTGGCTGAGCCAGGTGCGG - Intronic
1167560281 19:50222909-50222931 GCAGGGGGCTGAGCTGGGTGGGG + Intronic
1167940540 19:52942643-52942665 GGCGGGGCCTGAGCGAGGTAGGG + Intronic
1167946617 19:52993580-52993602 GGCGGGGCCTGGGCGAGGTGGGG + Intergenic
1167987823 19:53333668-53333690 GGCGGGGCCTGAGCGAGGTAGGG - Intergenic
1168103239 19:54152309-54152331 GCACCTGACCGAGCGAGGTGAGG + Exonic
1168386654 19:55968942-55968964 GGAGGTCACTGAGCGAGGAGTGG - Intronic
925274223 2:2637435-2637457 GCAAGTTCCTGAGCAGGGTGGGG - Intergenic
925736636 2:6969474-6969496 GCAGGAGCATGAGCAGGGTGTGG - Intronic
926282040 2:11457393-11457415 GCAGGTGCATCACTGAGGTGAGG + Intronic
926306924 2:11644058-11644080 GCAGGAGCAAGAGAGAGGTGGGG + Intergenic
926367936 2:12150652-12150674 GCAGGAGCCAGAGTGAGTTGAGG - Intergenic
926735535 2:16070718-16070740 GGGGGTGCCTGGGAGAGGTGGGG - Intergenic
927889203 2:26738013-26738035 ACAGGTGCCTGAGAGAGGAAGGG - Intergenic
934522428 2:95027551-95027573 GCAGGTGCCTGGGAGAGAAGAGG + Intronic
937409509 2:121660873-121660895 GCAGGTGGATTAGCCAGGTGTGG + Intergenic
938271875 2:129979776-129979798 GCAGGTCTCTGAGCCGGGTGCGG + Exonic
938960312 2:136334907-136334929 GCAGGAGCAAGAGAGAGGTGGGG + Intergenic
939629968 2:144518128-144518150 GCATGTGTGTGAGTGAGGTGGGG - Intronic
941395736 2:164970494-164970516 GCAGGGGCCTGACCCAGATGTGG + Intergenic
944464053 2:199982704-199982726 GGAGGAGCCTGAGAGAGGGGGGG - Intronic
946153128 2:217789595-217789617 ACAGGTGCCTCAGCGGGGTGGGG + Intergenic
948046995 2:234952323-234952345 GCGGGTGCCTGGGCGTGGGGCGG + Intronic
948282411 2:236757538-236757560 CCAAGTTCCTGAGGGAGGTGAGG - Intergenic
948479318 2:238240190-238240212 GCAGCTGGCTGAGCTAGGCGGGG + Intronic
948730164 2:239958078-239958100 GCAGGTGCCCGAGTGATCTGGGG - Exonic
948733177 2:239980023-239980045 GCAGGGGACTGAGGGATGTGGGG - Intronic
1169552689 20:6717393-6717415 GCATGAGCCTGTGCCAGGTGAGG + Intergenic
1172483504 20:35285312-35285334 GCAGGTGCTGGAGAGAGGGGAGG + Intergenic
1172523109 20:35582107-35582129 GGAGGTGGCTGGGCAAGGTGTGG - Intergenic
1173213230 20:41054293-41054315 GCAGGTGCGGGGGCGGGGTGGGG - Intronic
1173516166 20:43667010-43667032 GGAGGGGCCTGAGTGAGGGGCGG - Intronic
1174089369 20:48034806-48034828 GCATGTGCCTCAGGTAGGTGGGG + Intergenic
1174187368 20:48716288-48716310 GCAGGGGCGAGAGGGAGGTGAGG - Intronic
1174507358 20:51025001-51025023 GGAGGGGCCTGAGTGGGGTGGGG + Intergenic
1174515702 20:51090836-51090858 GCAGGTACCTGAGCTAAGTCAGG - Intergenic
1174543604 20:51308454-51308476 GCAGGTGCCTCAGGGTAGTGGGG + Intergenic
1175218680 20:57404838-57404860 GCAGGTGCCAGGCCCAGGTGGGG + Intronic
1175481207 20:59312485-59312507 GCAGGTGCCTGTGTTAGGGGAGG + Intronic
1176863776 21:14030315-14030337 CCAGGTGTCTGAGGGAAGTGAGG + Intergenic
1179813175 21:43885154-43885176 GCAGTTGGCTGAGGGAGGTGGGG - Intronic
1179991382 21:44949842-44949864 GCAGGTGCCTGGGGGTGGAGTGG - Intronic
1180101745 21:45590775-45590797 GCAGGAGCCTGGGAGAGGGGCGG - Intergenic
1180611859 22:17103574-17103596 GCAGGTGGGTGAGTGTGGTGTGG + Exonic
1180682616 22:17638870-17638892 GCAGGGGCCAGGGCCAGGTGAGG + Exonic
1180720059 22:17901380-17901402 GCAGCAGCCTGGGCCAGGTGAGG + Intronic
1180802147 22:18636908-18636930 GAAGGTGCCTGAGCCAGGTGAGG - Intergenic
1180853385 22:19032460-19032482 GAAGGTGCCTGAGCCAGGTGAGG - Intergenic
1181085893 22:20439134-20439156 GCTGGTGCAGGAGGGAGGTGGGG + Intronic
1181158110 22:20937574-20937596 GTAGGTGCCTGAGAGAGGTCAGG + Intronic
1181219575 22:21358351-21358373 GAAAGTGCCTGAGCCAGGTGAGG + Intergenic
1182163728 22:28150741-28150763 GGAGGTGCCAGTGCCAGGTGTGG + Intronic
1183081208 22:35457903-35457925 GCAGGTTCTTGAGCGAAGTTAGG + Intergenic
1183341582 22:37284640-37284662 GCTGGAACCTGAGCGAGGTCCGG - Intronic
1184513597 22:44946861-44946883 GCAGGTGGCTGAGCTAGCAGGGG - Intronic
1184688493 22:46107080-46107102 GCAGGGACCAGGGCGAGGTGTGG - Intronic
1184745637 22:46454129-46454151 GCAGGGGTCGGAGTGAGGTGAGG + Intronic
1185105458 22:48867076-48867098 AGAGGTGCCTGAGCGCGGTCAGG + Intergenic
1185245938 22:49772855-49772877 GCGGGTGCAGGAGCCAGGTGGGG - Intergenic
1185414744 22:50703921-50703943 GCACGTACCTGTGTGAGGTGAGG - Intergenic
1185417265 22:50717077-50717099 GCAGGGTCCTGAGGCAGGTGAGG - Intergenic
950645531 3:14374504-14374526 GCTGGTGCCTGAGCGACGTGAGG + Intergenic
950706813 3:14787988-14788010 GCAAGTGCCTGGCCAAGGTGAGG + Intergenic
952480661 3:33758448-33758470 ACAGGTTCCTGGGAGAGGTGGGG + Intergenic
953004794 3:38968308-38968330 TCAGGCCCCTGAGCCAGGTGGGG - Intergenic
954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG + Exonic
955887842 3:63619335-63619357 GGAGGTGCATGCGTGAGGTGGGG + Intergenic
958560774 3:95744849-95744871 GCAGGCGGCTGGGGGAGGTGGGG - Intergenic
961330468 3:126135277-126135299 GGAGGTGCCTGGTGGAGGTGAGG - Intronic
961652069 3:128421663-128421685 GCAGGTTTATGAGCGGGGTGGGG + Intergenic
961907987 3:130282378-130282400 GCTGGTCCCTAAGCAAGGTGAGG + Intergenic
962255269 3:133866159-133866181 GCAGGTAACTGAGCAAGGTAAGG + Intronic
963270451 3:143281033-143281055 TCAGGTGCCTGAAGTAGGTGCGG + Intronic
963880250 3:150520546-150520568 GCCGGTCCCCCAGCGAGGTGTGG - Intergenic
966232522 3:177667026-177667048 GCTGGTGGCTGAGCTTGGTGAGG + Intergenic
966945852 3:184776657-184776679 GGACGTGCCTGAGGGGGGTGGGG + Intergenic
967443790 3:189540736-189540758 GCAGGTGCAGGAGCAAGGTGAGG - Intergenic
968280596 3:197473982-197474004 GCAGGTTCCTGAGAGGGGTCTGG - Intergenic
968425058 4:517736-517758 GGAGTTGCCTGAGGCAGGTGTGG + Intronic
969128879 4:4975814-4975836 GCAGGAGACAGAGAGAGGTGGGG - Intergenic
969365005 4:6689303-6689325 GGAGGAGGCTGAGAGAGGTGAGG - Intergenic
969389009 4:6876853-6876875 GCTGGTTCCTGGGAGAGGTGGGG - Intronic
969464734 4:7349509-7349531 GCAGGGGGCTGGGTGAGGTGGGG + Intronic
969627734 4:8316328-8316350 GCAGGTGCCTGGGCCGGATGAGG - Intergenic
969835117 4:9834151-9834173 GCAGAGGCCTGAGTGAAGTGAGG - Intronic
970556886 4:17242874-17242896 GCAGATGCCTGAGTGTGGGGAGG - Intergenic
971058651 4:22941872-22941894 GCAGGTGGCTCAGTGATGTGAGG + Intergenic
976092409 4:81471936-81471958 GCAGGCGCCTGAGCCAAGGGGGG - Intronic
978749530 4:112231706-112231728 GCAGGGGCCTGGGCGCGCTGGGG + Intergenic
981503238 4:145474559-145474581 GCAGGAGAGAGAGCGAGGTGGGG + Intergenic
985269385 4:188179415-188179437 GCAGGCTCCTGAGTCAGGTGGGG + Intergenic
985580993 5:695034-695056 CCAGGGGGCTGAGCGAGGTCTGG + Intergenic
985595618 5:786366-786388 CCAGGGGGCTGAGCGAGGTCTGG + Intergenic
985760363 5:1745802-1745824 GAAGGTGGCTGAGTGTGGTGAGG + Intergenic
985786308 5:1897076-1897098 GTAGGTGCCTCAGCAAGGTGGGG + Intergenic
987489548 5:18560260-18560282 GCAGGTGCCTGAGGAGGCTGAGG - Intergenic
988884079 5:35535976-35535998 GCAGGAGCCAGAGAGAGATGGGG + Intergenic
989142369 5:38214419-38214441 GCACGTGACTGTGTGAGGTGTGG + Intergenic
994742695 5:103641798-103641820 GAAGGGGCCTGAGCAAGTTGGGG - Intergenic
995361087 5:111298546-111298568 GCAGGTGTCTGGGCAACGTGGGG - Intronic
997434624 5:133865432-133865454 CCAAGTGCCTGTGAGAGGTGGGG + Intergenic
997663672 5:135609473-135609495 ACAGGTGCCTGAGTGAGGGAAGG + Intergenic
998017649 5:138745403-138745425 GAAGGTGCCTGGCAGAGGTGAGG + Intronic
998404276 5:141865058-141865080 GCAGGTGTCTGACCGAGATGAGG - Exonic
1000279834 5:159773144-159773166 GCAGGTGACTGAATGAGGGGTGG + Intergenic
1001089170 5:168724477-168724499 CCAGGTACCTGAAAGAGGTGTGG + Exonic
1002158976 5:177303837-177303859 GCAGCTGCTTGGGCGCGGTGCGG + Exonic
1002425190 5:179170787-179170809 GGAGGTGCATGAACGAGGAGGGG - Intronic
1002795471 6:467860-467882 GCGGGGACCTGAGCGAGGGGTGG - Intergenic
1003097916 6:3156880-3156902 GCAGGTGACTGCGCTGGGTGGGG - Intronic
1003427833 6:6009047-6009069 GCACGAGTCTGAGCGAGGTTGGG - Intergenic
1003627236 6:7753154-7753176 GCAGGTGCTTGATTGAGGTCAGG - Intronic
1003708287 6:8559919-8559941 CCAGGTGCCTGAACGAGAAGGGG + Intergenic
1004837375 6:19543651-19543673 GTTGGTGGCTGAGCTAGGTGAGG - Intergenic
1005496387 6:26391770-26391792 CCTGGTGCCTGAGGGATGTGTGG - Intronic
1006046758 6:31305549-31305571 GCATGGGCCTGAGAGTGGTGGGG - Intronic
1006342106 6:33452602-33452624 GCTGGTCCCAGAGCGGGGTGAGG + Exonic
1006517114 6:34551245-34551267 GCAGTTGCCTTAGTGGGGTGTGG + Intronic
1006946977 6:37791222-37791244 GCAGGTGCCTAAGGGAGGGTAGG + Intergenic
1006983225 6:38162097-38162119 CCAGGTGGCTGTGCCAGGTGAGG + Intergenic
1008567372 6:52782732-52782754 GCAGGAGGGTGACCGAGGTGGGG + Intergenic
1008570803 6:52815057-52815079 GCAGGAGGGTGACCGAGGTGGGG + Intergenic
1010509059 6:76694957-76694979 GCATGTGCCTGAGGGAGGTTGGG + Intergenic
1010791882 6:80074806-80074828 GCAGGTGCTTGAGGCAGCTGTGG + Intergenic
1011399075 6:86940156-86940178 GGTGGTGCTTGAGCCAGGTGGGG - Intronic
1012611659 6:101226924-101226946 TCAGGTGCCTGAGGGAGCAGGGG + Intergenic
1013111900 6:107070855-107070877 GCAGGAGCCTGGGCAATGTGTGG - Exonic
1014874692 6:126643491-126643513 GCAGCTGCTTGGGCGCGGTGCGG + Intergenic
1017900547 6:158715511-158715533 GCTAGTCCCTGGGCGAGGTGTGG + Intronic
1018062637 6:160102676-160102698 GCGGGTGGCAGGGCGAGGTGGGG + Intronic
1019094383 6:169567076-169567098 GCAGCAGCCCGAGCCAGGTGGGG + Intronic
1019195790 6:170282040-170282062 GCAGCTTCCTGAGGGAGGAGAGG + Intergenic
1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG + Intronic
1019280762 7:198865-198887 GCAGGTGCCTGAGCCTCATGAGG + Intronic
1019529967 7:1498546-1498568 GCAGCTCCCTGGGTGAGGTGAGG + Exonic
1022481237 7:30744369-30744391 GGAGTTGCCAGAGCGAGGTGGGG - Intronic
1023159603 7:37284406-37284428 TCAGAAGACTGAGCGAGGTGAGG + Intronic
1025187320 7:56871290-56871312 GCCGCTGCCTAAGTGAGGTGAGG + Intergenic
1025188738 7:56881100-56881122 GCTGCTGCCTGAGTGAGGTGAGG + Intergenic
1025683196 7:63695820-63695842 GCTGCTGCCTGAGTAAGGTGAGG - Intergenic
1025684605 7:63705630-63705652 GCCGCTGCCTAAGTGAGGTGAGG - Intergenic
1025990336 7:66492532-66492554 GCCGCTGCCTGAGTGAGGTGAGG + Intergenic
1026038413 7:66846062-66846084 GCCGCTGCCTGAGTGAGGTGAGG - Intergenic
1027212988 7:76165524-76165546 GCCGCTGCCTGAGTGAGGTGAGG + Intergenic
1030293341 7:107893630-107893652 GCAGGGTCCTGAGTGAAGTGGGG + Intronic
1030386661 7:108874987-108875009 CCAGGTGCCTGAGCCAGGAGGGG - Intergenic
1030676894 7:112393769-112393791 GCAGGAGCAAGAGAGAGGTGAGG - Intergenic
1033243486 7:139700107-139700129 ACACTTGCCTGTGCGAGGTGGGG + Intronic
1034414116 7:150955912-150955934 GCAGGAGCCTGGGCGGGCTGCGG - Intronic
1034541147 7:151759108-151759130 GCAGGTGCTGGAGTGAGGTCAGG - Intronic
1035325659 7:158064404-158064426 GGAGGTGCATGAGGGAGCTGTGG + Intronic
1035433646 7:158841316-158841338 TCAGGAGGCTGAGTGAGGTGGGG - Intergenic
1037779333 8:21856895-21856917 GCAGATTCCTGATGGAGGTGGGG - Intergenic
1037948822 8:23005846-23005868 GCAGATACCTAAGCCAGGTGTGG + Intronic
1038128170 8:24697603-24697625 GCAGGTTACAGAGCCAGGTGGGG + Intergenic
1039278419 8:35956496-35956518 TCAGGTGCCTGAGGGAGCAGGGG - Intergenic
1040872695 8:52117153-52117175 GCAGGTGAGTGAGCTGGGTGGGG - Intronic
1045701295 8:104869884-104869906 GCAGGAGCCAGGGAGAGGTGTGG + Intronic
1046613303 8:116448838-116448860 GCAGCTGCCTGGGCCAGGTCAGG + Intergenic
1048236195 8:132693058-132693080 GCTGGTGAGTGAGCCAGGTGGGG + Intronic
1048334313 8:133491621-133491643 GGAGGTGCCTGAAGGAGCTGAGG + Intronic
1049229930 8:141476740-141476762 GCTCTTGCCTGAGCGAGGTGGGG - Intergenic
1049311053 8:141934098-141934120 TCAGGTTCCTGAGGGAGGCGAGG - Intergenic
1049381901 8:142320371-142320393 GCAGGTGCAGGAGGGCGGTGTGG - Intronic
1049466722 8:142754409-142754431 GCAGCTGCCTGATTGGGGTGTGG + Intergenic
1049597770 8:143492601-143492623 GCAGGTGTGGGTGCGAGGTGAGG - Intronic
1049620138 8:143594439-143594461 GCAGGGCCCTGAGGAAGGTGAGG + Intronic
1049708891 8:144054952-144054974 GCAGGGGCCAGAGCGGGGTGGGG + Intronic
1049944402 9:580401-580423 GCAGATGCCTGAGCCAGCAGTGG - Intronic
1050210597 9:3251462-3251484 GCAAGTGCCTATGGGAGGTGAGG - Intronic
1051991772 9:23161110-23161132 GGAGGAGCATGAGCTAGGTGTGG + Intergenic
1057910423 9:99015924-99015946 GCAGCCTCATGAGCGAGGTGAGG + Intronic
1060520661 9:124292227-124292249 GCAGGTGGCTGAGCCAGCGGTGG - Intronic
1061283918 9:129611671-129611693 GCAGGTGCCTGCTTCAGGTGTGG + Intronic
1061924366 9:133798704-133798726 GCAGCTGCCTCAGCGAGTGGTGG - Intronic
1062396296 9:136354142-136354164 CCAGGGGCCAGAGCCAGGTGGGG + Intronic
1062587737 9:137257038-137257060 CCAGGCGCCAGGGCGAGGTGAGG + Exonic
1185453443 X:295291-295313 GCAGGAGCCTGAGGGAGGGAGGG + Intronic
1185960360 X:4541666-4541688 GCTGGTGGCTGAGCTTGGTGAGG + Intergenic
1186749763 X:12609460-12609482 GCACAAGCTTGAGCGAGGTGAGG + Intronic
1186784416 X:12944366-12944388 GCTGGTGGCTGAGCTTGGTGAGG - Intergenic
1187798120 X:23027074-23027096 GCAGATGTCTGAGGGAGGAGAGG - Intergenic
1187826297 X:23335315-23335337 GCAGCTGCCTGGGCTAGGAGAGG - Intronic
1188162016 X:26815477-26815499 GCAGGGGCATGAGGGAGGTGTGG + Intergenic
1190314740 X:49143280-49143302 TCAGGTGCCTGAGGGAGCAGGGG + Intergenic
1190417785 X:50198407-50198429 GGAGGAGCCTGAGGGAGGAGTGG - Intronic
1191899087 X:66022680-66022702 GAAGGTGCCTGAGAGAGGGAAGG + Intronic
1200167681 X:154048511-154048533 CCTGGTGACTGAGCGAGGTAAGG - Intronic
1202037337 Y:20648200-20648222 TCAGGTGCCTGAGGGAGCAGGGG - Intergenic