ID: 954682553

View in Genome Browser
Species Human (GRCh38)
Location 3:52353564-52353586
Sequence TGCTCTCGATATGGTCCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954682553_954682559 2 Left 954682553 3:52353564-52353586 CCTGCAGGACCATATCGAGAGCA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 954682559 3:52353589-52353611 AGCAAGGTGGCTGAGGTGGCTGG 0: 1
1: 0
2: 5
3: 153
4: 2064
954682553_954682563 29 Left 954682553 3:52353564-52353586 CCTGCAGGACCATATCGAGAGCA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 954682563 3:52353616-52353638 GAGTACGCCATCGAGCAGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 27
954682553_954682561 25 Left 954682553 3:52353564-52353586 CCTGCAGGACCATATCGAGAGCA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 954682561 3:52353612-52353634 CAAGGAGTACGCCATCGAGCAGG 0: 1
1: 0
2: 0
3: 0
4: 42
954682553_954682558 -2 Left 954682553 3:52353564-52353586 CCTGCAGGACCATATCGAGAGCA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 954682558 3:52353585-52353607 CATCAGCAAGGTGGCTGAGGTGG 0: 1
1: 0
2: 2
3: 37
4: 401
954682553_954682557 -5 Left 954682553 3:52353564-52353586 CCTGCAGGACCATATCGAGAGCA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 954682557 3:52353582-52353604 GAGCATCAGCAAGGTGGCTGAGG 0: 1
1: 0
2: 1
3: 55
4: 329
954682553_954682560 7 Left 954682553 3:52353564-52353586 CCTGCAGGACCATATCGAGAGCA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 954682560 3:52353594-52353616 GGTGGCTGAGGTGGCTGGCAAGG 0: 1
1: 1
2: 6
3: 95
4: 731
954682553_954682562 28 Left 954682553 3:52353564-52353586 CCTGCAGGACCATATCGAGAGCA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 954682562 3:52353615-52353637 GGAGTACGCCATCGAGCAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954682553 Original CRISPR TGCTCTCGATATGGTCCTGC AGG (reversed) Exonic