ID: 954685615

View in Genome Browser
Species Human (GRCh38)
Location 3:52368654-52368676
Sequence CCCGGCGGCCAGGCTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954685615 Original CRISPR CCCGGCGGCCAGGCTTCCCT GGG Intronic