ID: 954687482

View in Genome Browser
Species Human (GRCh38)
Location 3:52378636-52378658
Sequence CCTTGTGGAAGCCACCATCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 145}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954687476_954687482 -7 Left 954687476 3:52378620-52378642 CCCACTTCACGGAGCCCCTTGTG 0: 1
1: 0
2: 0
3: 13
4: 97
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145
954687469_954687482 15 Left 954687469 3:52378598-52378620 CCAGCTGGGGCCCCCCACATTGC 0: 1
1: 0
2: 1
3: 30
4: 878
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145
954687465_954687482 24 Left 954687465 3:52378589-52378611 CCTATTCCCCCAGCTGGGGCCCC 0: 1
1: 0
2: 4
3: 31
4: 319
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145
954687467_954687482 17 Left 954687467 3:52378596-52378618 CCCCAGCTGGGGCCCCCCACATT 0: 1
1: 0
2: 0
3: 18
4: 198
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145
954687471_954687482 4 Left 954687471 3:52378609-52378631 CCCCCACATTGCCCACTTCACGG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145
954687477_954687482 -8 Left 954687477 3:52378621-52378643 CCACTTCACGGAGCCCCTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145
954687473_954687482 3 Left 954687473 3:52378610-52378632 CCCCACATTGCCCACTTCACGGA 0: 1
1: 0
2: 1
3: 8
4: 100
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145
954687466_954687482 18 Left 954687466 3:52378595-52378617 CCCCCAGCTGGGGCCCCCCACAT 0: 1
1: 2
2: 1
3: 30
4: 280
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145
954687468_954687482 16 Left 954687468 3:52378597-52378619 CCCAGCTGGGGCCCCCCACATTG 0: 1
1: 0
2: 0
3: 16
4: 160
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145
954687475_954687482 1 Left 954687475 3:52378612-52378634 CCACATTGCCCACTTCACGGAGC 0: 1
1: 0
2: 0
3: 13
4: 123
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145
954687474_954687482 2 Left 954687474 3:52378611-52378633 CCCACATTGCCCACTTCACGGAG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145
954687470_954687482 5 Left 954687470 3:52378608-52378630 CCCCCCACATTGCCCACTTCACG 0: 1
1: 0
2: 0
3: 12
4: 138
Right 954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG 0: 1
1: 0
2: 0
3: 5
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954687482 Original CRISPR CCTTGTGGAAGCCACCATCA TGG Exonic
900793272 1:4693159-4693181 CCTTGGAGAAGCCCCCATGAAGG + Intronic
907911824 1:58833867-58833889 CCTTTTGGCAGACAGCATCAGGG + Intergenic
910730817 1:90393880-90393902 CCTTGTGTATGCCTCAATCATGG + Intergenic
913997164 1:143660992-143661014 CTTCGTGTAAGCCACCAACAGGG + Intergenic
914505061 1:148281604-148281626 CTTCGTGTAAGCCACCAACAGGG - Intergenic
914507503 1:148302544-148302566 CTTCGTGTAAGCCACCAACAGGG + Intergenic
917751634 1:178058542-178058564 CCTGGTGAAAACCACCATCTCGG - Intergenic
921285839 1:213608348-213608370 CCCTGTGGAAGCCACTCTCCTGG + Intergenic
1062918866 10:1265056-1265078 CCTTTTGGAAGCAGGCATCAAGG - Intronic
1063407490 10:5811445-5811467 GCTTGTGGAAGCCTGCATGATGG + Intronic
1067332502 10:45334661-45334683 CCTGGTGGCAGCCACCACAAGGG + Intergenic
1068843067 10:61638003-61638025 CATTGTGGAAAACACCATGAAGG - Intergenic
1069777082 10:70933526-70933548 CCTTCTCCAAGCCACCACCATGG + Intergenic
1074396671 10:113103796-113103818 CCTAGTGTAGCCCACCATCATGG - Intronic
1074822641 10:117192500-117192522 CATTGTGATACCCACCATCAAGG + Intergenic
1075257047 10:120933550-120933572 CCTTCCCCAAGCCACCATCATGG - Intergenic
1080919109 11:36690915-36690937 CCTCATACAAGCCACCATCAGGG - Intergenic
1084287319 11:68140679-68140701 CACTGTGGATGTCACCATCAGGG + Intergenic
1084324422 11:68391432-68391454 CCTTGTTGACGTCACCATCGGGG + Intronic
1084529974 11:69721446-69721468 CTTTGGAGAAGACACCATCATGG - Intergenic
1088136220 11:106559036-106559058 CCATGTGGATGTCATCATCATGG - Intergenic
1088429927 11:109747777-109747799 GCTTGGGGAAGCCACAAGCAGGG + Intergenic
1089392394 11:118111130-118111152 TCTTCTGGCAGCCACCACCACGG - Intronic
1090268695 11:125370895-125370917 GCTTTTGGGAGCCCCCATCATGG + Intronic
1091123252 11:133074560-133074582 CCTCCTGGAAGCCAACCTCAAGG - Intronic
1092237129 12:6817308-6817330 CCTGCTGGAATCCAACATCAAGG + Exonic
1092456521 12:8648699-8648721 CTTTGTGCAAGCCACCTGCAAGG - Intronic
1103160469 12:118725008-118725030 CCTTGAGGAGCTCACCATCAGGG + Intergenic
1103934770 12:124469382-124469404 CCTTCTTGAAGCGACCACCAGGG - Intronic
1105059284 12:133133828-133133850 CCTTGTGGCAGCCAAAATAATGG + Intronic
1105560270 13:21484196-21484218 CCTTGTGAAAAAGACCATCAGGG - Intergenic
1110179045 13:72593361-72593383 TCTTCTGAAAGCCACAATCAAGG - Intergenic
1113480178 13:110615026-110615048 CCTATTTGAAGCCACCGTCATGG - Intergenic
1116135352 14:40916057-40916079 GCATGTGGAAACCTCCATCAAGG + Intergenic
1119154847 14:72400481-72400503 CTTTGTGTAAGGCACCTTCAAGG + Intronic
1119381627 14:74232896-74232918 CTTTGGGGAAGCTACCCTCAAGG + Intergenic
1121898776 14:97673174-97673196 ACATGAGGCAGCCACCATCAAGG + Intergenic
1124617830 15:31255287-31255309 CCTCCTGGAAGCCTCCATCTTGG + Intergenic
1126245489 15:46499816-46499838 CCTGCTGCAAGCCACCATCGTGG + Intergenic
1126807776 15:52369613-52369635 CCTTGTTGAAGCCTGCATTAAGG - Intronic
1126974739 15:54163011-54163033 CCTTGTGGTAGACAGCATAATGG + Intronic
1128127560 15:65204286-65204308 CCTGAAGGCAGCCACCATCAAGG - Exonic
1128136027 15:65264147-65264169 CCTTATGGAGGGCACCACCAGGG - Intronic
1128880946 15:71242480-71242502 CATTTTAGAAGGCACCATCATGG - Intronic
1129312209 15:74720704-74720726 CCTTGTCGATAGCACCATCAGGG + Exonic
1129868910 15:78928712-78928734 CCTGGGGGAGGCCACCCTCAGGG + Intronic
1130300619 15:82677755-82677777 CTTTGTGGCAGCCACAATCCAGG - Exonic
1131878689 15:96838971-96838993 CCTTGGGTATGCCACCATCCAGG - Intergenic
1133313641 16:4868112-4868134 CCCTGTGGAAGTCTGCATCAGGG - Intronic
1133750755 16:8723429-8723451 CCTTGTGGCAGCCTGCATCTGGG + Intronic
1134341055 16:13346517-13346539 CTTTGTGAAAGCCAACAACAAGG - Intergenic
1136001037 16:27292900-27292922 CCTTCTGGAAGTCACCAGTACGG - Intergenic
1139933639 16:70550759-70550781 CCCTCTGAAAGACACCATCAGGG - Intronic
1140671794 16:77286896-77286918 CCTTGGGGAAGCCATCCTTATGG - Intronic
1141141117 16:81497468-81497490 CCTTCTGGGAGCCACCAGCTGGG - Intronic
1141590041 16:85062393-85062415 GTTGGTGGAAGCCTCCATCATGG + Intronic
1144599759 17:16601322-16601344 CCTTGTTGAAACCATCATCCAGG + Intergenic
1145889509 17:28405129-28405151 CCTGCTGGAAGCCAGCATCGGGG - Exonic
1148570159 17:48661894-48661916 CCTTATGGCAGCCACTTTCATGG + Intergenic
1151477476 17:74352292-74352314 CCTGGAGCAGGCCACCATCATGG + Exonic
1152626139 17:81388707-81388729 CCTGGTGGAAGCTGCCTTCAGGG + Intergenic
1154075374 18:11195587-11195609 CCCTGGGGATGGCACCATCAAGG - Intergenic
1157581578 18:48776948-48776970 GGGTGAGGAAGCCACCATCAGGG - Intronic
1165134852 19:33661438-33661460 CCTTGTGGAGGTCACCTTTATGG + Intronic
1165620076 19:37238600-37238622 CTTTTTGGCAGCCACCATTATGG + Intronic
1167519889 19:49948164-49948186 CCCTGCAGAGGCCACCATCAGGG + Intronic
1167812655 19:51848010-51848032 GCTGTTGGAAGCCACCATCTTGG + Intergenic
927092819 2:19725353-19725375 CCCTGTGGAATCCACCGTGAGGG - Intergenic
932369904 2:71178310-71178332 ACTCCTGGAAGCCATCATCAGGG - Intergenic
935351973 2:102158868-102158890 CCTAGAGAAAGCCATCATCATGG - Intronic
935998810 2:108803699-108803721 ACTTGTAGAAGCAACCCTCAAGG - Intronic
936106628 2:109630493-109630515 TCCTGTGGAAACCACCATAAAGG + Intergenic
937311909 2:120907991-120908013 CCTGGTGAAAGCCCCCAGCAGGG + Intronic
942134962 2:172916106-172916128 TCTTGTGGAGCACACCATCAGGG - Intronic
948073242 2:235144455-235144477 CCTTATGAAAGCCACCCTCCAGG - Intergenic
948456298 2:238106111-238106133 GCTGGTGGAAACCACCACCAAGG - Intronic
1168796632 20:614161-614183 CCTTGTGCTTGCCTCCATCACGG + Intergenic
1168870677 20:1125602-1125624 CCTTGTGAAAGCCATCACCGTGG + Exonic
1175920079 20:62446557-62446579 CCTGGTGGGAGCCAGCAGCAGGG - Intergenic
1178497980 21:33103053-33103075 GGTTGTGGAAGGCAGCATCAGGG - Intergenic
1179154575 21:38838821-38838843 CCTTGGAGAAGCCACCATGGAGG + Intergenic
1181006120 22:20014542-20014564 CCATGACTAAGCCACCATCAGGG + Intronic
1181546348 22:23604645-23604667 CCTCGTGGAAGCCCTCACCACGG + Intergenic
1181802396 22:25356105-25356127 CCTTGTTGACGTCACCATCGGGG - Intronic
1183571350 22:38656038-38656060 GCTTGTAGAAGCCGCCATAACGG + Intronic
1184280215 22:43433203-43433225 TCTTCTGGAAGCTTCCATCAGGG - Intronic
951766771 3:26208397-26208419 TCTTCTGGAAGCCACAGTCAAGG + Intergenic
954637333 3:52078206-52078228 CCTCGTGGTGGCCACCATCAGGG + Intronic
954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG + Exonic
954952573 3:54488441-54488463 CCTTATGAAACCCTCCATCATGG + Intronic
955400439 3:58587287-58587309 CCTTGTTGATGCTACCAGCATGG + Intronic
961039732 3:123669207-123669229 CCTGGTGGAAGCCCTCATCCTGG - Intronic
962519685 3:136186687-136186709 CCTTGTGGAAAACACGCTCAGGG + Intronic
964417504 3:156462931-156462953 CCTTCTGAAAGCCACAACCAAGG - Intronic
964679516 3:159322213-159322235 CCGTGTGGAAGACACCATTTTGG + Intronic
966417547 3:179705046-179705068 CCTGGTCCTAGCCACCATCATGG - Intronic
969897398 4:10318185-10318207 CCCTGTGGCAGCCACCTTCCAGG - Intergenic
974847970 4:67374288-67374310 CTTTGTGGAAGTCACGATAAAGG + Intergenic
976008569 4:80459788-80459810 TCTTTTGGAAGCCACAGTCAAGG - Intronic
980734995 4:136873258-136873280 CCTTGTGGACCCCACCATGCAGG - Intergenic
983369819 4:166843219-166843241 CCCTGTGGGAGCCACCCTCTGGG - Intronic
986015472 5:3753601-3753623 CCTCGTGGACTCAACCATCAGGG + Intergenic
988207465 5:28158512-28158534 CTTTTCGGAAGCCACCATTAAGG + Intergenic
994806423 5:104452753-104452775 GCTTGTGGGAGAAACCATCACGG + Intergenic
995838655 5:116422615-116422637 TCTTGTGCAGTCCACCATCAGGG + Intergenic
996816866 5:127583832-127583854 CCTTGTGGAAGGCAGCATAATGG + Intergenic
1000627420 5:163555172-163555194 CTTTATGGCAGCCACCATGATGG - Intergenic
1001908059 5:175489576-175489598 CCTTCTTGCTGCCACCATCATGG - Intronic
1002906519 6:1453532-1453554 TCTTCTGGAAGCCACAGTCAAGG + Intergenic
1012004420 6:93694730-93694752 CCTTGTGGACACCACCATTTGGG - Intergenic
1015360283 6:132331954-132331976 ACTTCTGGAAGCCACTAGCAGGG + Intronic
1019802382 7:3097702-3097724 CTTTGTGGCAGGCACCATGATGG - Intergenic
1022113544 7:27245283-27245305 CCTGCCGGAAACCACCATCAAGG + Exonic
1023708146 7:42964031-42964053 TCTTCTGGAAGCCACAGTCAAGG - Intergenic
1024479286 7:49847681-49847703 TCCCGTGGAAGCCACCATGAGGG - Intronic
1024561404 7:50648329-50648351 CCATGTGGATGCCACCCTGATGG + Intronic
1027160066 7:75795926-75795948 CCTGGCGGAAGCCACCCTGAAGG - Intergenic
1027247536 7:76377359-76377381 CCTTGTGTAAGACACCATGTGGG - Intergenic
1027260743 7:76462617-76462639 CTTTCTGGTAGCCACCATCCGGG + Intronic
1027312122 7:76960730-76960752 CTTTCTGGTAGCCACCATCCGGG + Intergenic
1028680436 7:93522874-93522896 CCTTTTGGAAGCAAAAATCAAGG + Intronic
1029179160 7:98687397-98687419 CCGTGTGAAAGCCACCATGATGG + Intergenic
1031452310 7:121937273-121937295 CCTGTTGGAAGCCAGAATCAAGG + Intronic
1031885649 7:127243284-127243306 CCTTCTGGAGGCTACCATCAGGG + Exonic
1032754624 7:134877214-134877236 CCTTTTGGCAGCTACCATCTGGG + Intronic
1033372782 7:140726482-140726504 CCTTCAAGTAGCCACCATCATGG - Intronic
1034123502 7:148650170-148650192 CTCTGTGGAAGCAACCAACAAGG + Intergenic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1035426704 7:158782941-158782963 CCGTGGAGAAGCCACCAGCAGGG + Intronic
1036997037 8:13669827-13669849 CATTTTAGAAGCCACCATTACGG + Intergenic
1039405954 8:37312648-37312670 CCTTGTGGAAGGCAATATCTAGG - Intergenic
1039949598 8:42158772-42158794 CCATGTAGAAGACATCATCATGG - Intronic
1040796343 8:51293273-51293295 CCTTGGGGAAGCCCACATCTAGG + Intergenic
1041024736 8:53672529-53672551 TCCTGTGGAAACCACCATAAGGG - Intergenic
1042962141 8:74315165-74315187 CCACGTGGACGCCACCACCACGG - Exonic
1048804775 8:138229890-138229912 CATGGAGGAAGCCACCCTCATGG + Intronic
1049307310 8:141911219-141911241 CCTGGTGGAAAACGCCATCAAGG - Intergenic
1050806553 9:9687357-9687379 CTTTGTGGAAGCCTTCATAAGGG + Intronic
1055680170 9:78706312-78706334 CCATGTGGAAGCCATCATATTGG + Intergenic
1056700798 9:88905770-88905792 ACTTGTGAAAGTCACCATCCAGG - Intergenic
1056752779 9:89364095-89364117 CCATGGGGAAGCCACCTCCAGGG - Intronic
1056796522 9:89662533-89662555 CCATCTGGAAGCCACCCTCAGGG + Intergenic
1057700042 9:97357290-97357312 CCTCGTGGAAGCCACAGTCCTGG + Intronic
1061021802 9:128020539-128020561 CCTTGTGGAGGCCAACAACCCGG - Intergenic
1061366525 9:130174846-130174868 CCATTTAGAATCCACCATCATGG - Intronic
1062405383 9:136393757-136393779 CCATGGGGAAGCCCCCTTCATGG + Intronic
1187447398 X:19371755-19371777 CCTTGTAAGAGCCCCCATCAAGG + Intronic
1189618450 X:42810198-42810220 TCTTCTGGAAGCCACAGTCAAGG - Intergenic
1198169884 X:134095186-134095208 CCAAGTGGAAGCCACCAGAATGG + Intergenic
1199137010 X:144265751-144265773 CCTGCTGGAGGCCTCCATCATGG + Intergenic
1200226552 X:154420776-154420798 CCTGCTGGAAGCCAGCAGCAGGG - Intronic