ID: 954688160

View in Genome Browser
Species Human (GRCh38)
Location 3:52381846-52381868
Sequence TCCAGGGCGTGCTGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 353}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954688151_954688160 11 Left 954688151 3:52381812-52381834 CCCTCACAAGGCTCGCCTCGCAC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG 0: 1
1: 0
2: 5
3: 30
4: 353
954688152_954688160 10 Left 954688152 3:52381813-52381835 CCTCACAAGGCTCGCCTCGCACA 0: 1
1: 0
2: 0
3: 6
4: 42
Right 954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG 0: 1
1: 0
2: 5
3: 30
4: 353
954688150_954688160 19 Left 954688150 3:52381804-52381826 CCGCAGCTCCCTCACAAGGCTCG 0: 1
1: 0
2: 0
3: 12
4: 181
Right 954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG 0: 1
1: 0
2: 5
3: 30
4: 353
954688153_954688160 -4 Left 954688153 3:52381827-52381849 CCTCGCACATGTGAGCGCCTCCA 0: 1
1: 0
2: 0
3: 6
4: 66
Right 954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG 0: 1
1: 0
2: 5
3: 30
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954688160 Original CRISPR TCCAGGGCGTGCTGGGCAGT GGG Intronic
900318073 1:2069295-2069317 TCCAGGAGGTGATGGGCAGCTGG + Intronic
900573911 1:3373666-3373688 TCCTGGGGGTGCTGGGCAAGCGG + Intronic
901438773 1:9264944-9264966 GCCAGGGCACGCTGGGCAGGTGG - Exonic
901704079 1:11060251-11060273 TCCGGGGCGGGCTGGGCCGGCGG + Intergenic
901725164 1:11236036-11236058 TCCAGGTACTGCTGGGCACTGGG - Intronic
902873448 1:19327419-19327441 TTCAGGGCGTGTGGGGCAGGTGG + Intronic
902966918 1:20011879-20011901 TCCAGGGGGTGGTGGGGAATGGG + Intergenic
903860760 1:26363181-26363203 TGCTAGGGGTGCTGGGCAGTTGG - Intronic
904010205 1:27385145-27385167 ACCAGGGCCTGCTGGGGGGTGGG + Intergenic
904471719 1:30740411-30740433 TGCGGGGCGTGGTGGGGAGTGGG - Intronic
905627295 1:39497685-39497707 TTCAGGGGTTGCTGGGGAGTAGG - Intronic
905836811 1:41131708-41131730 ACCAGGGCCTGCTGGGGGGTGGG - Intronic
907091893 1:51732818-51732840 TCCAGGACATGCTGGGCAGCTGG - Intronic
907383559 1:54110830-54110852 ATCAGGGCATGCTGGGCAGAGGG - Intronic
907634843 1:56123930-56123952 ACCAGGGCCTGTTGGGGAGTGGG - Intergenic
909041304 1:70655390-70655412 ACCAGGGCCTGTTGGGGAGTGGG + Intergenic
909392862 1:75136207-75136229 TAAAGGGGGTGCGGGGCAGTGGG - Intronic
909734181 1:78935389-78935411 ACCAGGGCCTGCTGGGGAGTGGG + Intronic
910076246 1:83282587-83282609 ACCAGGGCTTGTTGGGCGGTGGG - Intergenic
911849868 1:102804541-102804563 TCCGGGGCGTGTTGTGGAGTGGG - Intergenic
912388140 1:109282908-109282930 TCCAGGGCAATCTGGGCAGTTGG - Intronic
912451576 1:109770656-109770678 TCCAGGGCTGTCAGGGCAGTGGG - Intronic
912467032 1:109881419-109881441 TCCAGGTCGTGCTGAGGAGTTGG + Intergenic
912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG + Intronic
913045509 1:115070560-115070582 ACTAGGGCATGGTGGGCAGTAGG - Intronic
915345512 1:155195112-155195134 CCCGGGGCGCGCTGGGGAGTTGG - Intergenic
915649656 1:157300212-157300234 ACCAGGGCCTGCTGGGGGGTGGG + Intergenic
915807744 1:158872425-158872447 ACCAGGGCCTGTTGTGCAGTGGG + Intergenic
917971009 1:180207714-180207736 TGCAGGAGGTGCTGGGCACTGGG + Intergenic
918844590 1:189593525-189593547 TCCATGGCTTCCTGGGAAGTTGG + Intergenic
919985924 1:202674861-202674883 GGCAGAGCATGCTGGGCAGTGGG - Intronic
920128583 1:203713225-203713247 ACCAGGGTGTGCTTGTCAGTGGG - Exonic
920951935 1:210580495-210580517 ACCAGGGCCTGCTGGGGGGTGGG - Intronic
921509977 1:216016179-216016201 ACCAGGGCCTGCTGGGGGGTGGG + Intronic
922857677 1:228788981-228789003 GACAGGCTGTGCTGGGCAGTGGG - Intergenic
923192855 1:231636959-231636981 ACCAGGGCCTGCTGGGGGGTAGG - Intronic
923328794 1:232903530-232903552 TTCAGGCCATGATGGGCAGTGGG - Intergenic
924274687 1:242373786-242373808 ACCAGGGCCTGTTGTGCAGTGGG + Intronic
1063053372 10:2477080-2477102 TCCAGGGCTTGCTTGGCCATGGG + Intergenic
1063178156 10:3570831-3570853 TGCAGGGTGTGCTGGGCACTAGG - Intergenic
1064146934 10:12833234-12833256 TCCAGGGCATGATGGACACTAGG - Exonic
1067582842 10:47456327-47456349 CCCCGGGTGTGCTGGGCAGGGGG + Intergenic
1068116708 10:52744111-52744133 TCCAGGGGAGGCTGGGCAGGAGG + Intergenic
1070827326 10:79398910-79398932 TCCAGTGCGTGAAGGGCAGCAGG + Intronic
1071173341 10:82894900-82894922 ACCAGGGCCTGTCGGGCAGTGGG - Intronic
1071255826 10:83870713-83870735 TCCAGGCTGTGCTGGGCTGGGGG - Intergenic
1071797235 10:89019881-89019903 CCCAGGGAGTGTTTGGCAGTAGG + Intergenic
1073905759 10:108277356-108277378 TTCAGGCCATGCTGGGAAGTGGG - Intergenic
1075101555 10:119509926-119509948 TCCAGGGAGTGATGGGCAGGGGG + Intronic
1075324192 10:121517555-121517577 TTCAGGGGGTGCTGGCCACTGGG + Intronic
1075589422 10:123680524-123680546 TCCAGGGCCCCCTGGGCAGAAGG + Intronic
1076027534 10:127128545-127128567 ACCGGGGCCTGCTGGGGAGTGGG - Intronic
1076525345 10:131109103-131109125 TCGGGGACGTGCTGGGCAGATGG - Intronic
1077282840 11:1753378-1753400 TCCAGGGCGCCCAGGACAGTGGG + Exonic
1077298903 11:1838299-1838321 AGCAGGGCGTTCTGGGCAGGCGG + Intergenic
1077364971 11:2157994-2158016 TCCAGGACTTGCAGGGCAGCTGG - Intronic
1077545413 11:3167162-3167184 TGCAGAGCCTGCTGGGAAGTGGG - Intergenic
1078088678 11:8250574-8250596 TCCAGGGAGCAGTGGGCAGTGGG - Intronic
1080182639 11:29443115-29443137 TCAAGGCTGTGCAGGGCAGTGGG + Intergenic
1081204811 11:40262817-40262839 ACCAGGGCCTGTTGGGGAGTAGG + Intronic
1081225669 11:40519076-40519098 ACCAGGGCCTGTTGGGGAGTGGG + Intronic
1081424876 11:42915172-42915194 ACCAGGGCCTGTTGAGCAGTGGG - Intergenic
1082135842 11:48547915-48547937 ACTGGGGAGTGCTGGGCAGTGGG - Intergenic
1082744641 11:56948574-56948596 ACCAGGGCTTGTTGGACAGTGGG - Intergenic
1083547044 11:63556589-63556611 GCCAGGCCATGCTGGGCACTGGG - Intronic
1083653699 11:64219184-64219206 TGCAGGGCGTCCAGGGCAGCTGG + Intronic
1083669019 11:64290276-64290298 TCCAGGGCTTGCTGGGGAGTTGG + Intergenic
1083734577 11:64672134-64672156 TACAGTGGGGGCTGGGCAGTGGG - Intronic
1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG + Intergenic
1088151613 11:106752516-106752538 ACCAGGGCCTGCTGGGGGGTCGG - Intronic
1088426669 11:109712463-109712485 ACCAGGGCCTGTTGGGGAGTAGG + Intergenic
1089273385 11:117316224-117316246 TCCCGGGCGGGCTGGGGAGGCGG + Exonic
1089744605 11:120607918-120607940 TCCAGGGGGTGGTTGCCAGTTGG + Intronic
1090148263 11:124351822-124351844 ACCAGGGCCTGTTGGGGAGTGGG + Intergenic
1090330691 11:125929934-125929956 TCTAGGGGGTGCTAGGCACTGGG - Intergenic
1091032567 11:132204106-132204128 TCCAGGTAGACCTGGGCAGTTGG + Intronic
1091639177 12:2221463-2221485 GCCAGGGCCTGCTGGGCAGTTGG + Intronic
1092024296 12:5227940-5227962 TCCAGGAAGGGCTGGGCAGCAGG - Intergenic
1092308851 12:7330914-7330936 ACTAGGGAGTGCTGGACAGTGGG + Intergenic
1092570597 12:9717041-9717063 TCCAGGACTTGCTGGGTAGAGGG - Intronic
1092628258 12:10351488-10351510 ACCAGGGCCTGTTGGCCAGTGGG - Intergenic
1093330704 12:17834434-17834456 ACCAGGGCCTGCTGGGGGGTGGG + Intergenic
1094491029 12:30960701-30960723 TGCAGGGCTTGCTGGCTAGTCGG + Intronic
1095857925 12:46881697-46881719 ACCAGGGCCTGTTGGGGAGTGGG + Intergenic
1097297300 12:57980554-57980576 ACCAGGGCCTGTTGGGGAGTAGG + Intergenic
1100789172 12:98111617-98111639 TCCAGGGCCTGTTGGGGGGTGGG - Intergenic
1101913037 12:108874933-108874955 TACAGGGCGTTCTGGGGAGGTGG + Intronic
1104257635 12:127154162-127154184 TGCCGGGCGAGCTGGGCAGTCGG - Intergenic
1104299255 12:127549331-127549353 TCCAGGGAGAGGTGGGCAGGAGG + Intergenic
1104823807 12:131694235-131694257 TGCAGGGCGGGCAGGTCAGTGGG - Intergenic
1105283449 13:18983868-18983890 ACCAGGGCTTGTTGGACAGTGGG + Intergenic
1106081290 13:26502079-26502101 TTCAGGGCTTGCTTGGAAGTGGG + Intergenic
1108075029 13:46670887-46670909 TCCATGTCGTGCTTGGGAGTAGG + Intronic
1108691006 13:52859187-52859209 TCTAGGGTGTGGTGGTCAGTGGG + Intergenic
1109570363 13:64180151-64180173 TTCAGGCCTTGCTGGGAAGTAGG - Intergenic
1110408282 13:75175138-75175160 ACCAGGGCCTGTTGGGGAGTTGG - Intergenic
1111918803 13:94389312-94389334 AGAAGGGCGTTCTGGGCAGTCGG + Intronic
1112366081 13:98756548-98756570 TCCAGGCCATGATGGGAAGTGGG + Intergenic
1112748873 13:102559966-102559988 ACCAGGGCCTGTTGGGGAGTGGG + Intergenic
1112962791 13:105148303-105148325 TACAGGCTGTGCTGTGCAGTGGG + Intergenic
1113127929 13:107000741-107000763 AGCAGGGCCTTCTGGGCAGTGGG - Intergenic
1113492861 13:110706028-110706050 TCCAGGCCGCGCTGGGCCTTGGG - Exonic
1113708071 13:112446904-112446926 TCCGGGGAGTGCTGGTCATTGGG - Intergenic
1113902246 13:113803801-113803823 TCCAGTGCCCGCTGGGCAGGGGG + Intronic
1113925331 13:113938816-113938838 GGAAGGACGTGCTGGGCAGTGGG - Intergenic
1114700775 14:24676067-24676089 ACCAGGGCCTGCTGGGGGGTGGG - Intergenic
1115617779 14:35112657-35112679 TTCAGGGCATGATGGGAAGTGGG + Intronic
1115849990 14:37583749-37583771 CCCGGGGCGCGCTGGGCAGAAGG - Intergenic
1116235970 14:42279887-42279909 ACCAGGGCGTGATGGGGGGTGGG - Intergenic
1116717228 14:48442945-48442967 ACCAGGGCCTGTTGGGGAGTTGG + Intergenic
1117198772 14:53366601-53366623 TCTAGGGAGTCCTGGGCAGGGGG + Intergenic
1119395977 14:74326706-74326728 TCCAGGGAGTGCTAGACAGCTGG + Intronic
1120299286 14:82685389-82685411 TCCTGGGCTTTCTGGGCAGAAGG + Intergenic
1121444237 14:93968597-93968619 GCCAGGGGGTGCTGGGCAGCTGG - Intronic
1122917969 14:104867512-104867534 CTCAGGATGTGCTGGGCAGTGGG + Intronic
1123155175 14:106218016-106218038 TAAAGGGCATGCTGGGCACTGGG - Intergenic
1126365916 15:47894380-47894402 ACCAGGGCCTGTTGGGGAGTGGG + Intergenic
1127126415 15:55816896-55816918 TCCAGGGACTAATGGGCAGTAGG - Intergenic
1127861581 15:62998229-62998251 TCTAGAGCATGCTGGGCAGGTGG + Intergenic
1129359025 15:75012856-75012878 GACTGGGCGTGCTGGGCAGCGGG + Intronic
1129405462 15:75313961-75313983 TCTAGGGCCTGCTTGGCAGGGGG - Intergenic
1129479127 15:75808883-75808905 TCTAGGGCCTGCTTGGCAGGGGG - Intergenic
1129746045 15:78021984-78022006 TCCAGGGCGTGCGTGACACTTGG - Intronic
1130096886 15:80862635-80862657 TCCAGGGCGGGCTGGACTGGGGG + Intronic
1130728165 15:86462589-86462611 TCCAGGGCCTGTTGGGAGGTGGG - Intronic
1130905264 15:88235627-88235649 GCCAGGGCCTGGTGGGCATTTGG - Intronic
1131089838 15:89615359-89615381 TCCAGAGGCTGCTGGGCTGTTGG + Intronic
1131508689 15:93037019-93037041 GGCTGGGCGAGCTGGGCAGTGGG + Intronic
1132871859 16:2118905-2118927 TCCAGGGCCTGGTTGCCAGTGGG - Intronic
1133786304 16:8976062-8976084 ACCAGGGCCTGCTGGGGGGTGGG - Intergenic
1134520668 16:14917991-14918013 TCCAGGGCCTGGTTGCCAGTGGG + Intronic
1134550907 16:15137983-15138005 TCCAGGGCCTGGTTGCCAGTGGG - Intronic
1134708340 16:16316642-16316664 TCCAGGGCCTGGTTGCCAGTGGG + Intergenic
1134715555 16:16356675-16356697 TCCAGGGCCTGGTTGCCAGTGGG + Intergenic
1134951262 16:18352003-18352025 TCCAGGGCCTGGTTGCCAGTGGG - Intergenic
1134959202 16:18395484-18395506 TCCAGGGCCTGGTTGCCAGTGGG - Intergenic
1135407100 16:22206462-22206484 CCCAGGGCGCGCGGGGCAGTCGG - Exonic
1136155592 16:28380068-28380090 GCCAGGTTCTGCTGGGCAGTGGG + Exonic
1136207492 16:28735221-28735243 GCCAGGTTCTGCTGGGCAGTGGG - Exonic
1138193467 16:55035262-55035284 TCCCAGGGGTGCTGGGCAGCGGG - Intergenic
1138722291 16:59096548-59096570 GACAGGGGGTGCAGGGCAGTGGG + Intergenic
1139477731 16:67211063-67211085 TTCAGAGGGTGCTGGGCATTGGG + Exonic
1141206128 16:81934363-81934385 TGCAGGGCGAGCTGGGAAGATGG + Intronic
1141478794 16:84292537-84292559 TCCAGGTCGTCCTGGTAAGTAGG + Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142066823 16:88067651-88067673 TGCAGGGGGGGCTGGGCACTGGG - Intronic
1144256284 17:13471509-13471531 TCCTGGGCGTGCTGGGGTGCTGG - Intergenic
1144359358 17:14477319-14477341 ACCAGGGCCTGTTGAGCAGTGGG + Intergenic
1144840755 17:18184194-18184216 TCCGGGGCGGGCGGGGCAGCCGG - Intronic
1145882529 17:28362942-28362964 TCCAGGGACTGCTTGGCAGGAGG + Exonic
1146913464 17:36663103-36663125 TCCAGGGCATGCTGCCCAGGTGG + Intergenic
1148215591 17:45832577-45832599 TCCAGGGAGGCCTGGGGAGTGGG - Intronic
1148777223 17:50102453-50102475 TCCTGACTGTGCTGGGCAGTGGG - Intronic
1148907174 17:50919015-50919037 CCCACGGTGTGCTGGGCAGGAGG - Intergenic
1149786147 17:59437015-59437037 TTCCGGGTGTGCTGGGCAGCTGG + Intergenic
1151477378 17:74351796-74351818 TCGAGGACGAGCTGGGCAGGCGG + Intronic
1151705253 17:75763953-75763975 TCCAGCGAGCGCTGGGCTGTGGG + Exonic
1152585642 17:81188346-81188368 GGCAGGGGGTGCAGGGCAGTGGG - Intergenic
1152633409 17:81420706-81420728 GCCTGGGCCGGCTGGGCAGTGGG + Intronic
1152855849 17:82664203-82664225 TCCCTGGGGTGCTGGGCAGATGG + Intronic
1155536751 18:26826483-26826505 TCCAGGGCTTGCTTGAGAGTGGG + Intergenic
1156133212 18:34003851-34003873 TTCAGGGCATGATGGGAAGTGGG + Intronic
1156725353 18:40120070-40120092 TCGGGGGAGTGCTGGACAGTGGG - Intergenic
1157216176 18:45785608-45785630 TCCTGGGTTTGCTGGGCTGTGGG - Intergenic
1160266236 18:77342545-77342567 TCAGGGGCGTCCTTGGCAGTAGG + Intergenic
1160795334 19:942657-942679 ACCAGGGCCTGCGGGGCAGTGGG - Intronic
1160987322 19:1845056-1845078 CACAGGGAGTGCGGGGCAGTGGG + Intronic
1161208967 19:3056538-3056560 TCCAGGGCGGGCTGGGATGCTGG - Intronic
1161224394 19:3136366-3136388 TCCAGGGCCGGCTGGGCTGGGGG + Exonic
1161273110 19:3401180-3401202 TGCAAGGCCTGGTGGGCAGTAGG + Intronic
1161421999 19:4181106-4181128 TGCAGGGCCTGGTGGGCCGTGGG - Intronic
1161431267 19:4233636-4233658 TCCAGGGTTTGGTGGGCAGTAGG - Intronic
1162015637 19:7845167-7845189 TACAGAGCGTGCCGGGCAGTGGG + Intronic
1162740262 19:12770054-12770076 TTCGGAGCGTGCTGGGCAGCTGG - Exonic
1164403002 19:27915238-27915260 ACCAGGGCCTGTTGGGGAGTTGG - Intergenic
1164590848 19:29506065-29506087 CGCAGGGCGTGCTGGGGCGTGGG - Intergenic
1164853480 19:31503048-31503070 TCCAGGGCGTGATCTGCAGTGGG - Intergenic
1166091601 19:40512900-40512922 TGCAGGGCGAGCTGGGCGGGCGG + Exonic
1167027434 19:46931273-46931295 TCCAGGGCCTGACGTGCAGTGGG - Intronic
1167120212 19:47512292-47512314 CCCAGGACTTGCTGGGGAGTGGG - Intronic
1167208217 19:48116736-48116758 TCCAGCCCTTGCTGTGCAGTGGG - Intronic
1167687679 19:50966865-50966887 TGCAGGGCGTGATGGGCATTTGG - Intronic
1167703691 19:51065842-51065864 TCCAGGACGTGCTGGGACCTAGG + Intergenic
925011904 2:492330-492352 TCCAGGGTGTGATGGGGAGCAGG - Intergenic
925474383 2:4196774-4196796 TGCAGGGCTTTCTGGGCAGCTGG + Intergenic
926272309 2:11375916-11375938 TCCAGGTACTTCTGGGCAGTTGG + Intergenic
927387169 2:22548183-22548205 ACCAGGGCCTGCTGGGGGGTGGG + Intergenic
927552341 2:24010732-24010754 GCCGGGCCGTGCTGGCCAGTGGG + Intronic
927589168 2:24338044-24338066 TTCAGGCCGTGATGGGAAGTGGG + Intronic
928222725 2:29418275-29418297 CCCAAGGAGTGCTGGGGAGTAGG - Intronic
928285611 2:29987751-29987773 TCCAGGGCAAGCTGGGGTGTAGG - Intergenic
928299891 2:30115800-30115822 TTCAGGAAGTGCTGGGCATTTGG - Intergenic
929223678 2:39490781-39490803 CCCAGGGTGTGGTGTGCAGTTGG + Intergenic
929663361 2:43812555-43812577 TCGAGAGAGTGCTGGGCAGATGG - Exonic
933388404 2:81640142-81640164 CCCAGGGCCTGTTGGGGAGTGGG + Intergenic
933696686 2:85223942-85223964 ACCAGGGCCTGTTGGGGAGTGGG - Intronic
937802332 2:126095037-126095059 ACCAGGGCCTGCTGGGGAGTCGG + Intergenic
938381176 2:130837303-130837325 TCCTGGGCGCGCGGGGCACTCGG + Intronic
938970084 2:136423838-136423860 TCCAGGGCGTACGTGGGAGTCGG - Intergenic
939506179 2:143050307-143050329 ACCAGGGCCTGCTGGGGGGTGGG - Exonic
942065255 2:172264862-172264884 ACCAGGGCCTGTTGGGGAGTAGG - Intergenic
943830495 2:192454012-192454034 ACCAGGGCCTGTTGGGGAGTTGG + Intergenic
945780480 2:214165622-214165644 TCAAGGGGGTGGGGGGCAGTGGG - Intronic
947117963 2:226791743-226791765 TCCCGGGCGGGCGGGGCGGTTGG - Intronic
947854350 2:233313162-233313184 GCCAGGGGGTGCTGGGCAAAGGG + Intronic
947875422 2:233464538-233464560 TGCAGGGCTTCCTGGACAGTGGG + Intronic
1169678712 20:8184946-8184968 ACCAGGGCCTGTTGGGGAGTGGG - Intronic
1170926138 20:20726145-20726167 ACCAGGGAGAACTGGGCAGTGGG + Intergenic
1171436659 20:25130057-25130079 ACCAGGGCGTGCAGGTGAGTAGG - Intergenic
1171989125 20:31682096-31682118 TCCAGGGCCTACTAGGCAGAAGG + Intronic
1172079938 20:32332186-32332208 TCCAGAGCATGCTCTGCAGTGGG + Exonic
1172934349 20:38609134-38609156 TCCAGGGAGTAGTGGGTAGTGGG + Intronic
1173558155 20:43982647-43982669 ACCATGCTGTGCTGGGCAGTGGG - Intronic
1174296813 20:49551243-49551265 TTCAGGCCGTGGTGGGAAGTGGG + Intronic
1175619462 20:60431195-60431217 GGCAGGGCGGGCTGGGTAGTGGG - Intergenic
1175900070 20:62356577-62356599 CCCAGGGCAAGCTGGGTAGTGGG - Intronic
1175912320 20:62410814-62410836 TCCAGGCCCTGGTGGGCAGGTGG + Exonic
1175992903 20:62798243-62798265 TGCAGGCCGTGCTGGGCAGGCGG + Intronic
1176138260 20:63534474-63534496 GCCAGAGCGTGCAGGGCAGGAGG - Intronic
1176672703 21:9749861-9749883 TCCAGGGTCTGCTGGGGAGGAGG - Intergenic
1177414116 21:20772234-20772256 ACCAGGGCCTGTTGGGGAGTGGG + Intergenic
1177572514 21:22905243-22905265 ACCAGGGCCTGTCGGGCAGTGGG + Intergenic
1177822651 21:26048482-26048504 TCAAAGTCGTCCTGGGCAGTGGG + Intronic
1179785210 21:43725967-43725989 TCCAGGCCATGCTGGGCAGCTGG + Intronic
1179976691 21:44872610-44872632 TCCAGGGCCTGGTGGGCTGCGGG - Intronic
1180046422 21:45308346-45308368 GCAGGGGCTTGCTGGGCAGTGGG + Intergenic
1181049879 22:20233442-20233464 TCCAGGGCGTCCTGGGCAGAAGG + Intergenic
1181551158 22:23639755-23639777 TCCAGGGAGGGCTGGGCCTTGGG + Intergenic
1181574812 22:23787086-23787108 GCCGGGGCGTGCTGGGCCGAGGG - Exonic
1181910854 22:26237035-26237057 GCCAGGGAGTCCTAGGCAGTGGG + Intronic
1182121613 22:27790856-27790878 TCCCGGGCCTCCTGGGCTGTGGG - Intronic
1183296106 22:37030448-37030470 TCCAGGTCGTGATGGGCAGGGGG - Intergenic
1184171385 22:42761705-42761727 TGCAGGGGCTGCTGGGCAATGGG + Intergenic
1184231860 22:43162717-43162739 TCCAGTGGGAGTTGGGCAGTGGG + Intronic
1184296039 22:43526239-43526261 TGCAGGGAGTGCTGGCAAGTTGG - Intergenic
1184776233 22:46624804-46624826 TCCAGGGGATGCTGGGCATCAGG + Intronic
1184860539 22:47171154-47171176 TCCAGGTGGTCTTGGGCAGTGGG - Intronic
950097308 3:10337745-10337767 CCCAGGGCGTGGTGGTCAGGGGG - Intronic
950569448 3:13790973-13790995 TCCAGGCCATGAAGGGCAGTGGG - Intergenic
950764227 3:15261442-15261464 GCCAGGAGGGGCTGGGCAGTTGG - Intronic
952899051 3:38097642-38097664 TGCAGGTGGAGCTGGGCAGTGGG + Intronic
953837684 3:46361483-46361505 TCCAGGGCCAGCTGTGGAGTGGG + Intergenic
954430069 3:50465955-50465977 TCCCGGGCCTCCTGGGGAGTGGG - Intronic
954661547 3:52229377-52229399 TCCAAGGCATGCAGGGCAGCAGG - Intronic
954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG + Intronic
954961170 3:54566254-54566276 TCCAGGACATGGTGGGCAGTGGG - Intronic
957244868 3:77703860-77703882 CTCAGGGCGTGCTGAGCTGTTGG + Intergenic
957458194 3:80480991-80481013 TCCAGGGCCTGTTGTGGAGTGGG + Intergenic
959041559 3:101427851-101427873 ACCAGGGCCTGTTGGGGAGTGGG - Intronic
959212754 3:103409916-103409938 TCGGGGGCGGGCTGGGCCGTAGG - Intergenic
959667064 3:108934163-108934185 ACCAGGGCCTGCTGGGGGGTGGG + Intronic
960065925 3:113372565-113372587 ACCAGGGCCTGTTGGGGAGTGGG + Intronic
960719838 3:120615269-120615291 ACCAGGGCCTGCTGGTGAGTGGG - Intergenic
961816954 3:129556038-129556060 TGCAGGCCGTGCTGGGCAGATGG + Exonic
963521141 3:146361193-146361215 TCAAGGCTGTGCAGGGCAGTGGG - Intergenic
963772538 3:149403060-149403082 ACTAGGGCGTGTTGGGCGGTGGG - Intergenic
964111141 3:153088974-153088996 ACCAGGGCCTGTTGGGGAGTCGG - Intergenic
964705248 3:159611515-159611537 ACCAGGGCGTGTTGGGGGGTGGG + Intronic
967345008 3:188445475-188445497 ACCGGGGCCTGTTGGGCAGTGGG + Intronic
967942019 3:194773427-194773449 TTTAGTGTGTGCTGGGCAGTAGG + Intergenic
968510355 4:992886-992908 TCCAGGGTGTCCTGGGCACCTGG - Exonic
968647480 4:1747926-1747948 TGCAGGGGGAGCTGGGCAGTGGG - Intergenic
968737033 4:2303073-2303095 CCCAGGGCCTGATGGGGAGTGGG + Intronic
968875243 4:3263229-3263251 TGCCGGGCGTGCTGGGCAGAGGG + Intronic
969446998 4:7250902-7250924 ACCAGGGCAGGCTGGCCAGTGGG + Intronic
970489414 4:16557199-16557221 ACTAGGGAGTGCTGGACAGTGGG + Intronic
970665976 4:18337425-18337447 ACCAGGGCCTGTTGGGGAGTAGG - Intergenic
970943948 4:21668215-21668237 ACCAGGGCCTATTGGGCAGTTGG + Intronic
971867532 4:32191384-32191406 ACCAGGGCCTGTTGTGCAGTGGG + Intergenic
971909150 4:32772305-32772327 CCCAGGGCCTTCTGGGAAGTAGG + Intergenic
974861908 4:67532733-67532755 ACCAGGGCCTGCTGGGGGGTAGG + Intronic
976402080 4:84618778-84618800 ACCAGTGTGTGCAGGGCAGTGGG + Intronic
976721611 4:88174326-88174348 ACCAGGGCCTGTTGGGGAGTAGG - Intronic
977736593 4:100424530-100424552 TGCAGTGCGTGCTGGGATGTGGG - Intronic
978416099 4:108477656-108477678 TCCAGGAAGAGCTGGGCAGAAGG - Intergenic
979953261 4:126921821-126921843 ACTGGGGCCTGCTGGGCAGTGGG + Intergenic
980988630 4:139719017-139719039 CACAGGGCATGCTGGGCAGAGGG + Exonic
981524732 4:145698677-145698699 TTCAGGGCATGATGGGAAGTGGG - Intronic
983560386 4:169095593-169095615 TCCTGGGCATGCAGGTCAGTTGG + Exonic
985262403 4:188127298-188127320 TCCAAGGTTTGCTGTGCAGTAGG - Intergenic
985402011 4:189601964-189601986 TCCAGGGTCTGCTGGGGAGGAGG + Intergenic
985580863 5:694436-694458 TCCAGGGCCTGCTGGACACCTGG - Intergenic
985595488 5:785768-785790 TCCAGGGCCTGCTGGACACCTGG - Intergenic
985975650 5:3417533-3417555 TCCAGGGCGAGCTGGATGGTGGG + Intergenic
985983416 5:3490503-3490525 AACAGGGTGTGCGGGGCAGTCGG - Intergenic
986076595 5:4344236-4344258 ACCAGGGCATGTTGGGGAGTAGG - Intergenic
986476537 5:8139617-8139639 CCCAGGACATGCTGGCCAGTGGG + Intergenic
987399284 5:17458163-17458185 ACCAGGGCCTGCTGAGGAGTGGG - Intergenic
987838519 5:23192018-23192040 ACCAGGGCTTGTCGGGCAGTGGG + Intergenic
988120985 5:26961981-26962003 ACCAGGGCTTGTTGGGGAGTTGG - Intronic
989767514 5:45104295-45104317 TCCAGGTCATGCTGGGCAAGAGG - Intergenic
990447027 5:55903110-55903132 CCCAGGGCGTGCTGAGCAGAAGG - Intronic
990536857 5:56731842-56731864 ACCAGGGCCTGTTGGGCGGTGGG + Intergenic
990703635 5:58502331-58502353 TCCAGGGCCTGCTAGGCAGCAGG + Intergenic
991951460 5:71950383-71950405 ACCAGGGCCTGCTGGGGGGTGGG - Intergenic
992444131 5:76819311-76819333 TCCTGGGCACGCTGGGCAGACGG + Intronic
993151964 5:84173436-84173458 TCCAGTGGGTGCAGGGGAGTTGG - Intronic
993471658 5:88314013-88314035 ACTAGGGAGTGCTGGACAGTGGG - Intergenic
997645156 5:135477149-135477171 TCCAGGAGTTGCTGGGCGGTGGG - Intergenic
997729853 5:136161060-136161082 TCCAGAACTTGCTGGGGAGTTGG - Exonic
997978467 5:138454173-138454195 TCCAGGGGGTGCTGGGGAAAGGG - Intergenic
998749876 5:145308204-145308226 TCCTGGGACTGCTGGGCATTTGG - Intergenic
999701553 5:154233215-154233237 TCCTGGGCCTGCTTGGCTGTTGG + Intronic
999801737 5:155044779-155044801 TTCAGGCCATGCTGGGAAGTGGG + Intergenic
1000111615 5:158113431-158113453 TGCAGAGGGTGCTGGGGAGTTGG + Intergenic
1000864350 5:166494045-166494067 TTCAGGGCATGCAGGCCAGTAGG - Intergenic
1001922452 5:175611220-175611242 GCCAGGCTGTGCTGGGGAGTGGG - Intergenic
1002953731 6:1841864-1841886 TGCAGGACGTTCTGGCCAGTGGG - Intronic
1003435755 6:6086490-6086512 CCCAGGGCTTTCTGGCCAGTAGG + Intergenic
1003832144 6:10023180-10023202 TCAAGGGCGTGGTGGGAAGGAGG - Intronic
1004585407 6:16994866-16994888 TACAGAGCGTGTTGGTCAGTGGG - Intergenic
1005471199 6:26164264-26164286 TCCAGGATGGGCTGGCCAGTGGG - Intronic
1006451257 6:34107044-34107066 TGGAGGCCGTGCTGGGCAGAGGG - Intronic
1007165196 6:39824210-39824232 TTCTGTGCCTGCTGGGCAGTAGG + Intronic
1009247045 6:61251374-61251396 ACCAGGGCCTGTTGTGCAGTGGG + Intergenic
1011099782 6:83708704-83708726 TCCAGGGCGGGCGGGGGACTGGG - Intronic
1011271568 6:85585222-85585244 ACCAGGACCTGCTGGGGAGTGGG + Intronic
1011296855 6:85835381-85835403 ACTAGGGAGTGCTGGACAGTGGG - Intergenic
1012974233 6:105762902-105762924 ACCAGGGCATGTTGGGGAGTAGG + Intergenic
1013240956 6:108245115-108245137 ACCAGGGCCTGCTGGGGATTGGG - Intronic
1014345912 6:120268740-120268762 GACAGGGGGTGCAGGGCAGTGGG - Intergenic
1015795308 6:137005373-137005395 TCCCGGGCCTGCTGTGCTGTAGG + Intronic
1018250139 6:161861411-161861433 ACCAGGGCCTGTTGGGCAATGGG + Intronic
1018632874 6:165835604-165835626 TCCAGGGAGGGCTTTGCAGTTGG + Intronic
1019920145 7:4158128-4158150 TGCAGGGCGTCCTGGCCAGGGGG - Intronic
1019937336 7:4265054-4265076 CCCGGAGCGTGCTGGGCAGGAGG - Intronic
1020110713 7:5446410-5446432 TCCAGTGCTGGCGGGGCAGTGGG - Intronic
1020873733 7:13668226-13668248 ACCAGGGCCTGCTGGGTGGTGGG - Intergenic
1022039280 7:26564816-26564838 ACCAGGGCCTGCTGGGGAGTTGG + Intergenic
1024004682 7:45216738-45216760 TGCAGGGGATGCAGGGCAGTGGG + Intergenic
1025715023 7:63947582-63947604 ACCAGGGCCTGTTGGGGAGTGGG + Intergenic
1027180372 7:75935161-75935183 TCCAGGGCGTGCTGGTGCGAAGG - Intronic
1027294020 7:76747880-76747902 ACCAGGGCTTGTTGGGCGGTGGG - Intergenic
1027671038 7:81099504-81099526 TCAAAGCCGTCCTGGGCAGTGGG + Intergenic
1029942120 7:104491341-104491363 GCCAGGGCCTGCTGGGGGGTAGG - Intronic
1030467878 7:109925097-109925119 ACTAGGGAGTGCTGGACAGTGGG - Intergenic
1033986232 7:147228811-147228833 TCCAGGGCCTGTTGGGGGGTGGG - Intronic
1034745232 7:153518199-153518221 AAAAGGGCATGCTGGGCAGTTGG - Intergenic
1034907549 7:154964053-154964075 ACCAGGGAGTTCTGGGAAGTGGG + Intronic
1035675231 8:1451430-1451452 TTCAGAGCGTGCTGGGCTGATGG - Intergenic
1037582989 8:20256770-20256792 TCCAGGGAGTGATGGAGAGTAGG + Intronic
1040063278 8:43122788-43122810 TCCAGAACGTCCTGGGCAGTGGG - Exonic
1041363316 8:57074238-57074260 ACCAGGGCCTGTTGGGGAGTGGG - Intergenic
1041462178 8:58123138-58123160 TCCAGGGGGTCCTTGGCAGGCGG - Intronic
1041900087 8:62972830-62972852 ACCAGGGCCTGTTGGGGAGTGGG - Intronic
1043633238 8:82363447-82363469 ACCAGGGCCTGTTGGGGAGTGGG - Intergenic
1044126452 8:88464113-88464135 ACCAGGGCCTGTTGGGGAGTGGG - Intergenic
1044636014 8:94324860-94324882 ACCAGGGCCTGTTGGGGAGTGGG + Intergenic
1045065108 8:98437419-98437441 CCCAGGGACTGCTGGGCAGATGG - Intronic
1045712391 8:105000147-105000169 ACCAGGGCCTGTTGGGGAGTGGG + Intronic
1047300670 8:123611225-123611247 ACCAGGGCCTGCTGGGGAGTGGG - Intergenic
1048304032 8:133271131-133271153 CCCAGGGCCTGCTGGGAAGGAGG - Intronic
1048844483 8:138594053-138594075 GCCAGGTCGTCCTGGGCAGGGGG - Exonic
1049059054 8:140261872-140261894 TCCAGGTTGTGTTGGGCAGGTGG - Intronic
1049316707 8:141973032-141973054 GCCAGGGTGTTCTGGGCAATGGG + Intergenic
1049797567 8:144503664-144503686 TCCAGGGGGTGCTGGGGGGAGGG - Intronic
1050333600 9:4569852-4569874 CCCAGGCCCTGCTGGGCATTGGG + Intronic
1051226846 9:14908342-14908364 TCCTGGGGCTGCTGGGCTGTAGG - Intronic
1056260500 9:84843424-84843446 TCCTGGGAGTGAAGGGCAGTGGG - Intronic
1057675119 9:97131814-97131836 AGCAGGATGTGCTGGGCAGTGGG - Intergenic
1058374904 9:104311257-104311279 ACCATGGCGTGTTGGGGAGTAGG + Intergenic
1059461800 9:114435624-114435646 TCCAAGGCTTCCTGGGCAGTTGG + Intronic
1060812408 9:126617224-126617246 TGCAGGGCGTGGTGGGGAGGGGG - Intronic
1061013647 9:127969641-127969663 AGCAGGGCCTGCTGGGCTGTGGG - Intronic
1061071963 9:128316415-128316437 TCCTGTGGGTGCTGTGCAGTCGG + Intronic
1061794154 9:133074622-133074644 TTCAGGCCATGATGGGCAGTAGG + Intronic
1062036428 9:134384614-134384636 TGCAGGGCGTGCTGGGGGGCAGG + Intronic
1185835434 X:3342226-3342248 ACCAGGGCCTGCTGGGGGGTGGG + Intronic
1186431469 X:9508921-9508943 ACCAGGGCCTGTTGGGGAGTGGG + Intronic
1186820540 X:13283605-13283627 TTCAGGCCGTGATGGGAAGTAGG - Intergenic
1190220586 X:48509878-48509900 TCAAGGCCCTGCTGGGCAGTAGG - Exonic
1190821589 X:53978271-53978293 TCCTGGGCGGTATGGGCAGTGGG - Intronic
1190880984 X:54492556-54492578 CCCTGGGCCGGCTGGGCAGTGGG + Intronic
1192693998 X:73395173-73395195 ACCAGGGCCTGTTGGGGAGTGGG + Intergenic
1194056082 X:89133924-89133946 TCCAGGGCCTGTTGGGGGGTGGG - Intergenic
1194941902 X:100020647-100020669 TCCAGTGTCTGCTGGGCTGTTGG - Intergenic
1195844601 X:109212387-109212409 ACCAGGGCCTGTCGGGCAGTGGG + Intergenic
1196635652 X:117999529-117999551 ACCAGGGCCTGCTGGGGGGTGGG + Intronic
1196799149 X:119526590-119526612 TCCACGTGGTGCTGGGCAGGGGG - Intergenic
1199600298 X:149537739-149537761 TCCTGGGTGTGCTGGGCAGTGGG - Intergenic
1199650286 X:149942201-149942223 TCCTGGGTGTGCTGGGCAGTGGG + Intergenic
1199734228 X:150669035-150669057 ACCAGGGCCTGTTGGGGAGTGGG - Intronic
1199980369 X:152917368-152917390 TCCATGGGGTGTTGGCCAGTCGG + Intronic
1200039076 X:153353078-153353100 TCCAGTGCTTGCTGGGCACTTGG + Intronic
1200208108 X:154332519-154332541 TGCTGGGGGTGCTGGGGAGTAGG - Intergenic
1200226204 X:154419294-154419316 TCCAGGGCCTGCATGGCACTTGG - Intronic
1201145396 Y:11062327-11062349 ACCTGGGCCTGCTGGGGAGTGGG - Intergenic
1201251473 Y:12062750-12062772 ACCAGGGCCTGTTGGGGAGTGGG + Intergenic
1201578725 Y:15488885-15488907 ACCAGGGCCTGTTGGGGAGTTGG - Intergenic