ID: 954692009

View in Genome Browser
Species Human (GRCh38)
Location 3:52400659-52400681
Sequence GAGATGCCCAGCGCCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954692007_954692009 -1 Left 954692007 3:52400637-52400659 CCTGTCCAAAAGCAACAAGGAAG 0: 1
1: 0
2: 0
3: 16
4: 244
Right 954692009 3:52400659-52400681 GAGATGCCCAGCGCCCTCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 227
954692008_954692009 -6 Left 954692008 3:52400642-52400664 CCAAAAGCAACAAGGAAGAGATG 0: 1
1: 0
2: 5
3: 37
4: 348
Right 954692009 3:52400659-52400681 GAGATGCCCAGCGCCCTCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 227
954692005_954692009 8 Left 954692005 3:52400628-52400650 CCTGCTTTACCTGTCCAAAAGCA 0: 1
1: 0
2: 1
3: 16
4: 316
Right 954692009 3:52400659-52400681 GAGATGCCCAGCGCCCTCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954692009 Original CRISPR GAGATGCCCAGCGCCCTCCC AGG Intergenic
900624405 1:3601566-3601588 GAGATGCTCAGCAGCATCCCTGG + Intronic
900649223 1:3722846-3722868 GAGGTGCCCAGCCCCATGCCAGG - Intronic
900885249 1:5410517-5410539 GAGTCTCCCAGGGCCCTCCCTGG - Intergenic
900963924 1:5944405-5944427 GAGGAGCCCAGCGCGCTCCTTGG - Intronic
901090445 1:6637399-6637421 GAGACCCCCAGCGCCCACCCTGG + Intronic
902375530 1:16028448-16028470 GAGATGCACATGGCCCGCCCCGG + Intronic
902414220 1:16229666-16229688 GGGCTGCCCAGAGACCTCCCAGG + Intergenic
902650847 1:17836652-17836674 GAGATGCCCATCGCAGTGCCCGG + Intergenic
902696288 1:18143017-18143039 AGGATGCCCAGAGCCTTCCCTGG + Intronic
902926180 1:19697227-19697249 GAGAGGCCCAGGGCACTCCCTGG - Intronic
903986830 1:27234831-27234853 GAGCCCCCCAGCCCCCTCCCCGG + Exonic
905011329 1:34748948-34748970 GAGGTGCTCAGAGCCCTGCCTGG - Intronic
905013677 1:34762976-34762998 GAGATGCCTGGGGGCCTCCCAGG - Exonic
905309274 1:37038141-37038163 AAGACTCCCAGCCCCCTCCCTGG + Intergenic
905315286 1:37078984-37079006 GAGATGCTAAGCAGCCTCCCTGG + Intergenic
906204875 1:43981401-43981423 GAGGTCCCCAGTGCCCTGCCCGG + Exonic
907735034 1:57104024-57104046 GAGAGGCCCAGGACCCTCCAGGG - Intronic
910973351 1:92879529-92879551 GTGATGCCCAGTGCCCTGCTGGG - Intronic
913319459 1:117578156-117578178 GTGAGGCCCAGGGCCCTGCCTGG + Intergenic
914913491 1:151804402-151804424 GGCATGCCCAGAGCTCTCCCGGG + Intronic
917503482 1:175606874-175606896 GAGATGCCCAGTGCACTCCAGGG + Intronic
917799945 1:178561252-178561274 CAGAAGCCCAGTGTCCTCCCAGG + Intergenic
919668254 1:200313586-200313608 GAGATGTTCAGGGCCCTTCCTGG + Intergenic
919982786 1:202652675-202652697 CTGATGCCCGGCCCCCTCCCAGG - Intronic
920056321 1:203195131-203195153 CAGATGCACAGCCCCCTGCCTGG + Intergenic
920506394 1:206518294-206518316 GCGAGGCCCAGGGCCCTCCCCGG + Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922216575 1:223524921-223524943 GAGAAGCCAAGAGCCCTCCTGGG - Intergenic
923750813 1:236744784-236744806 CAGATGCCCTCCGTCCTCCCGGG + Intronic
924589205 1:245387305-245387327 CAGATGCCCATCACCCTACCTGG + Intronic
1063118867 10:3090544-3090566 AAGAGGCTCAGCCCCCTCCCCGG + Intronic
1063122728 10:3115863-3115885 GAGATGCCCTGTGGCATCCCTGG + Intronic
1065869583 10:29945117-29945139 GAGGAGCCCACCGCCCTCCTTGG + Intergenic
1066569162 10:36752898-36752920 CAGGTGCCCACCGCCCTGCCAGG + Intergenic
1067749313 10:48959749-48959771 GAGACGTGCAGCTCCCTCCCTGG + Exonic
1069833719 10:71296010-71296032 GGGAAGCCCAGCTCCCTCCCGGG + Intronic
1070582131 10:77729533-77729555 GAAACGCCCAGTGCCCTCCAGGG + Intergenic
1075865868 10:125719167-125719189 GCGCGTCCCAGCGCCCTCCCCGG + Intergenic
1076262418 10:129078330-129078352 GAGATGCCAAGGGCCCTGCCAGG + Intergenic
1076882971 10:133248451-133248473 GTGAGGCCCAGAGCCTTCCCCGG + Intergenic
1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG + Exonic
1078662356 11:13297618-13297640 GGGATGCCCAGAGCCTCCCCTGG - Intronic
1080562966 11:33480851-33480873 CAGAAGCCCAGCTCCCTCCTAGG + Intergenic
1083550734 11:63588210-63588232 CAGATGCCCAGCACCATGCCCGG + Intronic
1083904700 11:65662284-65662306 GAGAAGCCAGGCTCCCTCCCAGG + Intronic
1084044793 11:66562327-66562349 GAGCTCCCCAGCTCCTTCCCAGG + Intronic
1084562953 11:69914410-69914432 AAGATGCCCAGCCCCCTCCCTGG - Intergenic
1084946101 11:72639423-72639445 TAGTGGCCCAGCGCCCTTCCTGG - Intronic
1085296844 11:75436156-75436178 TAGATGCCCAGAACCCACCCTGG - Intronic
1085896382 11:80644534-80644556 GAGATGCCCTGCGCCACCTCAGG + Intergenic
1088604185 11:111512715-111512737 GGGAGGACCCGCGCCCTCCCAGG - Intergenic
1089387695 11:118079025-118079047 GCAATGCCCAGCTCCTTCCCTGG - Intronic
1091044710 11:132315383-132315405 GAGAGGCCCAGGGCCCTGCCTGG - Intronic
1092112148 12:5971366-5971388 GAGAAGCCCAGGGCCCTCCCAGG - Intronic
1092155363 12:6278697-6278719 GCGCCGCCCTGCGCCCTCCCGGG - Intergenic
1096637703 12:52971614-52971636 GAGATGCACAGGCCCCTGCCAGG + Intergenic
1102044824 12:109823165-109823187 GCCATGCCCAGCACCTTCCCTGG + Intronic
1104410221 12:128551465-128551487 GAGATGCTCAGACCTCTCCCAGG - Intronic
1105378044 13:19863156-19863178 AAAATGCCCCGCGACCTCCCCGG + Intronic
1105389220 13:19959218-19959240 AAAATGCCCCGCGACCTCCCCGG - Intronic
1105642623 13:22281025-22281047 GGGAGGCCAAGCGCCCTGCCAGG + Intergenic
1106539079 13:30674188-30674210 GAGGTGCCCAGCGGCCGCCGCGG + Intergenic
1107279322 13:38715443-38715465 GAGATGCACATGGCCCTTCCTGG + Intronic
1107644267 13:42477789-42477811 GTGATGCCTGGCGCCCTGCCTGG + Intergenic
1108269836 13:48748817-48748839 GGGATAGCCAGCGCCCTGCCAGG + Intergenic
1110434421 13:75463447-75463469 GAGATTCCCAGGGCCCACACTGG + Intronic
1110656593 13:78007393-78007415 GAGATTCCCAGCTCCCGTCCAGG + Intergenic
1114319747 14:21537285-21537307 GAGAGGCCCAGGGCCCTTGCAGG - Intergenic
1117895732 14:60485240-60485262 GACATTCCCAGCCCCTTCCCGGG + Intronic
1118641751 14:67798902-67798924 GCGGAGCTCAGCGCCCTCCCCGG - Intronic
1119380935 14:74227710-74227732 TAGAAGCCCAGGGCCCACCCAGG + Intergenic
1119612709 14:76077207-76077229 GATATGCACAGGGCTCTCCCAGG + Intronic
1119731854 14:76956340-76956362 GAAATGCCCAGGGCCGGCCCAGG - Intergenic
1120834310 14:89026894-89026916 GAGTTCCCCAGCGCCGTGCCGGG - Intergenic
1121027709 14:90628643-90628665 GAGCTTCCCAGTGCCCTGCCAGG - Intronic
1122048569 14:99040178-99040200 CCGATGCCCAGCGCCTTCCCGGG + Intergenic
1122255667 14:100473805-100473827 GAGAAGCCCAGGCCCCTCCACGG - Intronic
1122364312 14:101185459-101185481 GATTTGCCCAGCTTCCTCCCGGG + Intergenic
1124016736 15:25883278-25883300 GTGAAGCCAAGAGCCCTCCCAGG + Intergenic
1125004211 15:34799581-34799603 GAGCGGCCCAGCCTCCTCCCCGG + Intergenic
1128333592 15:66771973-66771995 GAAAAGCCCACCGCCCTCCTAGG + Intronic
1128501802 15:68231772-68231794 GAAAGGCCCAGCCCCCTGCCAGG - Intronic
1128801610 15:70500628-70500650 GATATGCCCACCTCCCTGCCTGG - Intergenic
1130686298 15:86040687-86040709 GAGAGGCCCAGCAGCCTTCCAGG - Intergenic
1132395727 15:101472631-101472653 GAGCTGCTCAGCCTCCTCCCTGG - Intronic
1132468895 16:90726-90748 CAGTTCCCCAGCCCCCTCCCAGG - Intronic
1132728432 16:1348802-1348824 CAGCTGCCCACCGCCCACCCAGG - Exonic
1133278557 16:4652291-4652313 GAGATGCCAAGCACCCCACCTGG - Intronic
1134674827 16:16082788-16082810 CAGATGCACAGCGCCATGCCTGG + Intronic
1137331729 16:47504794-47504816 GTGAAGGCCAGCGCACTCCCTGG + Intronic
1138081253 16:54093428-54093450 GAGAAGCCCAGCTCCCTGGCAGG + Intronic
1138341691 16:56293812-56293834 CAGATGCCCAGCCGCCTCACCGG + Intronic
1139470839 16:67177368-67177390 GAGAGTCCAAGCCCCCTCCCGGG - Intronic
1139485730 16:67255645-67255667 ATGATGCCCACCGCACTCCCAGG - Intronic
1142133527 16:88441580-88441602 GGGAGGCCCAGCGCCCACCTGGG - Intergenic
1142509642 17:385762-385784 GCGTTTCCCAGCGCCCGCCCCGG - Intronic
1142528059 17:558850-558872 TAGATGCCCATCACCATCCCCGG - Intronic
1142597497 17:1036631-1036653 GGGGTGCCCAGCGCCCACACAGG + Intronic
1143872542 17:9967371-9967393 GAGATACTCAGCGTCATCCCTGG + Intronic
1144950778 17:18992354-18992376 GGGATCCCCAGTGCCCTGCCAGG + Intronic
1146669861 17:34729671-34729693 TAGATGCTCAGCGCCCCTCCAGG + Intergenic
1146931577 17:36781965-36781987 GAGATGCTGAGCGCCCTGCCTGG - Intergenic
1147319556 17:39637454-39637476 GAGATCCCGAACGTCCTCCCCGG - Intronic
1149013626 17:51883638-51883660 CAGTTTCCCAGCTCCCTCCCTGG + Intronic
1149896154 17:60429965-60429987 GAGATGCCCATCACCATGCCTGG + Intronic
1150300044 17:64040231-64040253 GAGAAGCCCAGCGCCCTGGAAGG - Exonic
1151767172 17:76138535-76138557 CGGCTGCCCAGCCCCCTCCCTGG - Intronic
1152786090 17:82248838-82248860 CCGAGGCCCAGCGCCCGCCCGGG + Intronic
1152816032 17:82408591-82408613 GAGGGGCCCTGCTCCCTCCCAGG + Intronic
1152879173 17:82805562-82805584 GACAGGACCAGCGCCTTCCCTGG - Intronic
1153842186 18:9017063-9017085 GTGAGGCCCAGGGCCCTGCCGGG + Intergenic
1154492935 18:14934972-14934994 CAGATGCCCTGCACCCTCCCAGG + Intergenic
1155555273 18:27011750-27011772 GAGAAGCCCAGCTCACTCACTGG - Intronic
1157293782 18:46427502-46427524 GAGCTGGCCAGTACCCTCCCGGG - Intronic
1157681578 18:49611668-49611690 AAGATGCCCAGCCCCACCCCAGG - Intergenic
1160053188 18:75455736-75455758 GAGGTGCGAAGCGGCCTCCCGGG - Intergenic
1160147383 18:76376193-76376215 GAGGTGCCGAGCCCCCTCACCGG + Intronic
1160190786 18:76712578-76712600 GACAGGCCCAGCGACCTCACAGG - Intergenic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
1161313410 19:3607098-3607120 CAGCCGCCCAGCGCCCTGCCAGG + Intergenic
1161361636 19:3853241-3853263 GAGAGGCCCACAGCCCTCCCCGG + Intronic
1161946406 19:7440130-7440152 GACAGGCACAGCGCGCTCCCCGG + Exonic
1163112085 19:15167472-15167494 GGAATGCCCAGCCCCATCCCTGG - Intronic
1163695691 19:18762199-18762221 CAGGTCCCCAGCGCCCGCCCGGG + Intronic
1164770177 19:30802201-30802223 AAGATGCCCGTGGCCCTCCCTGG - Intergenic
1165062805 19:33213031-33213053 AAGCTGCCCAGAGCCCTTCCCGG + Intronic
1167143006 19:47665097-47665119 GAGGTCTCCAGCACCCTCCCTGG + Intronic
925147287 2:1589555-1589577 GAAGTGCCAAGCGCCTTCCCAGG + Intergenic
925897087 2:8480889-8480911 GGGGTGACCAGGGCCCTCCCTGG + Intergenic
926976277 2:18519960-18519982 GAGATGCTCAGCGCAGTACCAGG - Intergenic
927236572 2:20880476-20880498 GGGATGCCCAGAGCCCTGGCTGG + Intergenic
927844304 2:26463501-26463523 GAGATGTCCAGAGGCGTCCCAGG + Exonic
929777402 2:44937839-44937861 GCGCTCCCCTGCGCCCTCCCTGG + Intergenic
932233857 2:70105584-70105606 GAGATGCCCAGCTCCAAGCCAGG - Intergenic
934861775 2:97769727-97769749 GGGATGCCCTGGGCCCTTCCTGG + Intronic
934917284 2:98310384-98310406 GAGATGCCTACCCCCCTGCCTGG - Intronic
938017639 2:127880707-127880729 CAGATGCCCTGCGGCCTCTCAGG - Intronic
944656401 2:201880582-201880604 GAAAGGCCCAGCTCCCTCTCAGG - Intronic
945019358 2:205555859-205555881 GAGATGCAAAGCTCCCTCCCAGG + Intronic
946056756 2:216909688-216909710 GACATGAGCAGAGCCCTCCCGGG - Intergenic
946339274 2:219057815-219057837 GAGAGGGACAGCACCCTCCCGGG - Intronic
948214989 2:236221953-236221975 CACATGCCCAGCACCCACCCTGG - Intronic
948274044 2:236694790-236694812 GAGGGGCCCAGCCCCCACCCAGG - Intergenic
948536408 2:238650665-238650687 GAAACTCCCAGCCCCCTCCCAGG + Intergenic
948682580 2:239645975-239645997 GAGATGCCCAGCGCCCTGCAAGG - Intergenic
948808958 2:240465359-240465381 GAGATGCCCAGCAGCTTCCAGGG - Intronic
948939975 2:241190730-241190752 GAGAGGCCCTGTGCCCTCCCTGG - Intronic
1172247096 20:33453121-33453143 GAGAAACCCAGGGCCCACCCAGG - Intergenic
1173256650 20:41398542-41398564 AAGATGCCCAGCTCCCCTCCTGG + Intergenic
1174084706 20:47998723-47998745 GAGAAGCCGAGCATCCTCCCTGG - Intergenic
1174270835 20:49367224-49367246 GAGATGTCCTCCGCCCACCCAGG + Exonic
1174909890 20:54595972-54595994 GAGAAGCCCAGCATCCTTCCAGG - Intronic
1175108126 20:56628767-56628789 GAGACGCCCAGTTCCCTCCGTGG - Intergenic
1175399811 20:58693616-58693638 GAGCTGCGCAGTGCCCTTCCAGG + Intronic
1175405361 20:58722596-58722618 GAGATGGCCCCTGCCCTCCCAGG + Intergenic
1175840220 20:62021952-62021974 GAGTTTCGGAGCGCCCTCCCGGG - Intronic
1175919831 20:62445653-62445675 GAGCTGCCCAGGACACTCCCAGG + Intergenic
1176189679 20:63802609-63802631 CAGACCCCCAGCACCCTCCCAGG + Intronic
1176189695 20:63802659-63802681 CAGACCCCCAGCACCCTCCCAGG + Intronic
1176276916 20:64277929-64277951 CAGCTGCCCAGGGCCCTCCTAGG - Intronic
1176276939 20:64278013-64278035 CAGCTGCCCAGGGCCCTCCTAGG - Intronic
1176301489 21:5101094-5101116 AAGCTGCCCAGTGCCCTCTCTGG - Intergenic
1178916360 21:36707705-36707727 GCGATGCCCAGGGCGTTCCCGGG + Intronic
1179569850 21:42272323-42272345 GAGATGCCAAGCACCCACACAGG - Intronic
1179855542 21:44160805-44160827 AAGCTGCCCAGTGCCCTCTCTGG + Intergenic
1180336176 22:11578599-11578621 GAGACTCCCAGCTCCCTCCATGG + Intergenic
1182380424 22:29883268-29883290 GCGCTGCCCAGCGCCGGCCCTGG + Exonic
1182854409 22:33504400-33504422 CAGGTGCCCACCGCCATCCCCGG + Intronic
1183177972 22:36238171-36238193 TGGATGCCCTCCGCCCTCCCTGG + Intronic
1183287035 22:36973288-36973310 GAGATGCCCAGCCCCTCCCTTGG - Intergenic
1183469300 22:37997156-37997178 GGGAAGCTCAGGGCCCTCCCAGG - Intronic
1183629167 22:39022720-39022742 GGGAGGCCCAGGGCCGTCCCGGG + Intronic
1184749637 22:46477929-46477951 GTGCTGCCCAGCATCCTCCCGGG - Intronic
1184759682 22:46537420-46537442 TTGATGCGCGGCGCCCTCCCGGG - Intergenic
1185218552 22:49617282-49617304 GAGAAGTCCAGCTGCCTCCCAGG + Intronic
950456552 3:13096101-13096123 AAAATGCCCAGCACCCTCCCTGG + Intergenic
950493054 3:13317891-13317913 GTGATGCCCCGAGGCCTCCCCGG + Intronic
954419814 3:50412891-50412913 GGGGTGCCCAGCACCCCCCCAGG - Intronic
954692009 3:52400659-52400681 GAGATGCCCAGCGCCCTCCCAGG + Intergenic
955409541 3:58646916-58646938 GAGGTTTCCAGGGCCCTCCCTGG + Intronic
956741987 3:72282340-72282362 GTGATGCCCTGAGCCATCCCAGG + Intergenic
961324958 3:126104442-126104464 GAGAGGACCAGCACCCTCCTGGG - Intronic
962266494 3:133948046-133948068 CAGATGCCCAGCCCTATCCCAGG - Intronic
965757286 3:172039888-172039910 GGGAAGCCCAGGGCGCTCCCGGG - Intronic
967753338 3:193140317-193140339 CAGATGCCCTGCTCCCACCCCGG - Intergenic
967849502 3:194071218-194071240 CAGCTGCCCCGCGCCCGCCCGGG - Intergenic
968353185 3:198080215-198080237 AGGGTGCCCAGCGCCCTCCAAGG + Intergenic
968469594 4:773302-773324 GAGATGACCAGAGTCCTCACTGG - Intergenic
968557155 4:1251391-1251413 CAGATGACCACCGCCCTCCAGGG + Intergenic
968658419 4:1788507-1788529 GGGAGGCCCAGCTCCCTGCCTGG - Intergenic
968982330 4:3856991-3857013 GAGAGGCCCACAGCTCTCCCAGG + Intergenic
971032344 4:22653328-22653350 TAGATGGCCAGAGCCTTCCCAGG + Intergenic
976567381 4:86566570-86566592 CAGATGCCCAGCACCATGCCCGG - Intronic
981541019 4:145846333-145846355 TAGATGCCCACCACCATCCCTGG - Intronic
982612619 4:157595874-157595896 GTGATGCCCACCACACTCCCAGG - Intergenic
986283494 5:6343142-6343164 GAGATGCCCCTCGCCATGCCTGG - Intergenic
986336584 5:6759941-6759963 GCGAGACCCAGCGCCCTCTCGGG - Intergenic
986421850 5:7593104-7593126 CAGCTGCCCAGCGCCCTCTGGGG + Intronic
988528545 5:32007800-32007822 TAGAGCCCCAGCCCCCTCCCTGG + Intronic
994366906 5:98928138-98928160 GACCCGCCCCGCGCCCTCCCAGG + Intronic
997228942 5:132228846-132228868 GAGATGCCCAGCCTCCGCCCAGG + Intronic
998790997 5:145766267-145766289 CAGATCCCCAGGCCCCTCCCAGG + Intronic
999693936 5:154171718-154171740 GAGATGGCCAGAGGCCTGCCTGG + Intronic
1001645512 5:173278819-173278841 GAGAAGCCCAGCGTCCACCCAGG - Intergenic
1002899275 6:1397153-1397175 GGGAGGCCCAGCGCGCCCCCTGG + Intergenic
1003623962 6:7726554-7726576 GCGCTGCCCCGCGCTCTCCCTGG - Intergenic
1004207564 6:13606487-13606509 GGGAAGTCCAGCGCTCTCCCTGG + Intronic
1004685136 6:17936112-17936134 GAGAGGCTCAGCCCTCTCCCTGG - Intronic
1004861046 6:19804953-19804975 GAGACGTCTCGCGCCCTCCCGGG - Intergenic
1005816199 6:29554612-29554634 CAGATGACCAGTGCCCTCCCCGG + Intergenic
1006504220 6:34477527-34477549 GAGATGGCCAGAGCCCTCAGGGG - Intronic
1006717707 6:36130810-36130832 TCAAGGCCCAGCGCCCTCCCCGG + Intronic
1006840842 6:37027118-37027140 GAGATGCTCAGCCCCTTCTCAGG + Intronic
1006930974 6:37688286-37688308 CAGATGCCCAGCCCCACCCCGGG - Intronic
1011132903 6:84070666-84070688 GAGCTGCCTAGTGCTCTCCCTGG + Intronic
1016833138 6:148452647-148452669 GAAATGCCCAGCACACTGCCTGG + Intronic
1017298705 6:152831325-152831347 GGGATGCCCAGAGCCCTTCGTGG + Intergenic
1018933520 6:168258290-168258312 CAGCTGCCCAGACCCCTCCCTGG + Intergenic
1019033046 6:169030082-169030104 GAGAGGACCAGCCCCCTCCGAGG - Intergenic
1019576525 7:1740265-1740287 GGGATGCCTATTGCCCTCCCTGG + Intronic
1019631554 7:2052399-2052421 GAGCTGTCCGGCGCCCTCCTGGG - Intronic
1019686306 7:2384023-2384045 GGGCTCCCCAGCCCCCTCCCTGG + Intergenic
1020776841 7:12464847-12464869 GAGAAGCCAAGAACCCTCCCAGG + Intergenic
1023433345 7:40117253-40117275 GAGGTGCCCAGCACCATGCCCGG + Intergenic
1031390014 7:121202440-121202462 AAGATGCCCATGGCTCTCCCAGG - Intronic
1032263332 7:130353470-130353492 GAGATGCCCATTGCACCCCCAGG - Intronic
1032694476 7:134322380-134322402 GAGCTGACCAGTGCCCTACCTGG - Intergenic
1032844356 7:135739901-135739923 GCTATGCCCAGCGCACACCCCGG - Intronic
1035242680 7:157542527-157542549 GAGCTGCCCAGCGGCCTCTCAGG + Intronic
1035276801 7:157752801-157752823 GAGATGGCCAGCTCCATCTCAGG + Intronic
1037715975 8:21400601-21400623 GTGAAGCCCAGAACCCTCCCGGG - Intergenic
1038020012 8:23544891-23544913 GAGAAGCCCAGCCTCCTCCCAGG + Intronic
1042642460 8:70951384-70951406 TAGAGGCCCAGGGCCCTCACAGG + Intergenic
1042722838 8:71843583-71843605 GAGATACCCAGGGCGCTCCTGGG - Intronic
1044992358 8:97807330-97807352 GTGATCCCCACCACCCTCCCAGG - Intronic
1048277073 8:133074700-133074722 GAGAAGCCCAGCCCCCAACCTGG - Intronic
1048742995 8:137582771-137582793 GATATGCTCAGTGCCATCCCTGG - Intergenic
1048962811 8:139594396-139594418 GAGATGCCTATAGTCCTCCCAGG - Intergenic
1049252377 8:141596240-141596262 GGGATGCCCATCCCTCTCCCTGG + Intergenic
1049592456 8:143468821-143468843 CAGATGCCCTGGGCCCTGCCAGG + Intronic
1049707775 8:144050791-144050813 GAGGTGCTCAGCGCGGTCCCTGG - Intergenic
1060615137 9:125006357-125006379 GAGATGCACACCCCCATCCCCGG + Intronic
1061035174 9:128109496-128109518 GAGAAGCCCAGCGACGTCCTCGG - Intergenic
1061108863 9:128552752-128552774 GAGCTGCCCAGCTCCCACCCGGG - Intronic
1061385878 9:130289145-130289167 AAGATGCCCAGTGCTCTCCCAGG - Intronic
1061786427 9:133031161-133031183 GAGATTCCCAGCCCCTTACCCGG - Exonic
1061935538 9:133855552-133855574 GAGAGGCCGGGTGCCCTCCCGGG - Intronic
1062424047 9:136497938-136497960 CAGATGACGAGCTCCCTCCCTGG - Intronic
1062463102 9:136670036-136670058 GAGGTGCCCAGGACCCTTCCAGG - Intronic
1185507827 X:643041-643063 CAGATCCCCAAGGCCCTCCCGGG - Intronic
1195936961 X:110134669-110134691 CAGATGCCCACAGCCCTGCCAGG - Intronic
1196888762 X:120272256-120272278 GAGGTGCCCAGAGCCCTCCATGG - Intronic
1197726898 X:129782436-129782458 GAGATGCACAGCACCGTGCCTGG - Intronic
1199595678 X:149504411-149504433 CTGAGGCACAGCGCCCTCCCTGG - Intronic
1200044890 X:153396156-153396178 GAGACCCCCAGCGCAGTCCCAGG - Intergenic