ID: 954692266

View in Genome Browser
Species Human (GRCh38)
Location 3:52401873-52401895
Sequence TCTCCTAGGAGCTGTCCTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 215}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954692266_954692274 25 Left 954692266 3:52401873-52401895 CCACCAGGACAGCTCCTAGGAGA 0: 1
1: 0
2: 0
3: 18
4: 215
Right 954692274 3:52401921-52401943 TGTCAACATGGTGGCATGTTGGG 0: 1
1: 0
2: 2
3: 8
4: 142
954692266_954692275 29 Left 954692266 3:52401873-52401895 CCACCAGGACAGCTCCTAGGAGA 0: 1
1: 0
2: 0
3: 18
4: 215
Right 954692275 3:52401925-52401947 AACATGGTGGCATGTTGGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 160
954692266_954692269 -8 Left 954692266 3:52401873-52401895 CCACCAGGACAGCTCCTAGGAGA 0: 1
1: 0
2: 0
3: 18
4: 215
Right 954692269 3:52401888-52401910 CTAGGAGAGAAAGCATAGTCAGG 0: 1
1: 0
2: 3
3: 10
4: 173
954692266_954692270 -4 Left 954692266 3:52401873-52401895 CCACCAGGACAGCTCCTAGGAGA 0: 1
1: 0
2: 0
3: 18
4: 215
Right 954692270 3:52401892-52401914 GAGAGAAAGCATAGTCAGGTAGG 0: 1
1: 0
2: 1
3: 25
4: 264
954692266_954692272 16 Left 954692266 3:52401873-52401895 CCACCAGGACAGCTCCTAGGAGA 0: 1
1: 0
2: 0
3: 18
4: 215
Right 954692272 3:52401912-52401934 AGGAACTTATGTCAACATGGTGG 0: 1
1: 0
2: 0
3: 16
4: 129
954692266_954692273 24 Left 954692266 3:52401873-52401895 CCACCAGGACAGCTCCTAGGAGA 0: 1
1: 0
2: 0
3: 18
4: 215
Right 954692273 3:52401920-52401942 ATGTCAACATGGTGGCATGTTGG 0: 1
1: 0
2: 0
3: 13
4: 166
954692266_954692271 13 Left 954692266 3:52401873-52401895 CCACCAGGACAGCTCCTAGGAGA 0: 1
1: 0
2: 0
3: 18
4: 215
Right 954692271 3:52401909-52401931 GGTAGGAACTTATGTCAACATGG 0: 1
1: 0
2: 0
3: 9
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954692266 Original CRISPR TCTCCTAGGAGCTGTCCTGG TGG (reversed) Exonic
900094646 1:935371-935393 TCTCCTGGGGCCTGTCCTGCAGG + Intronic
901130153 1:6957280-6957302 GCTGCTAAGAGCTGACCTGGAGG - Intronic
902447122 1:16474465-16474487 TCTCCCAGCAGCTGAGCTGGCGG - Intergenic
903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG + Intergenic
905319423 1:37105446-37105468 TCTCCAGGGTGCTGTCCTTGAGG + Intergenic
906051774 1:42880463-42880485 TCTCCTGAGAGCTGTACTGTTGG - Intergenic
907544017 1:55243603-55243625 TCTCTGAGGAGGTGACCTGGAGG - Intergenic
908992401 1:70108840-70108862 TCTCCTTGGAGCTGACTTGAGGG - Intronic
912547443 1:110461040-110461062 TATCCTGGGAGCTCTCCTGAGGG + Intergenic
913211891 1:116589187-116589209 TCCCCCAGGAACTGTGCTGGAGG - Intronic
913333462 1:117686341-117686363 TCTCCAGGGAGCTGTCTTGTGGG - Intergenic
913336262 1:117711187-117711209 TCTCCAAGGAGCTGTCCATTGGG + Intergenic
915942801 1:160129530-160129552 AGTCATATGAGCTGTCCTGGGGG - Intronic
918152750 1:181812456-181812478 TCTCCGAGGAGTTGTCAAGGAGG - Intergenic
919230414 1:194765796-194765818 TTTACTAGGAGTTGTTCTGGAGG - Intergenic
920387347 1:205578406-205578428 TCTCCTAACAGCTGGCCTTGAGG + Intronic
920704517 1:208241955-208241977 TCTCCTTGGTGGTGGCCTGGAGG - Intronic
921338045 1:214107882-214107904 TCTCCCAGGAGCTGGGCTGGGGG - Intergenic
923069406 1:230549071-230549093 GCACCGAGGAGCTGTCCGGGAGG + Intergenic
1062912211 10:1218692-1218714 TCCCCTTGGTGCTGTCCTCGTGG + Intronic
1064673646 10:17740281-17740303 TCACTGAGGAGCTTTCCTGGTGG + Intergenic
1067060013 10:43073459-43073481 CCTCCTCGCAGCTGCCCTGGAGG + Intergenic
1067089339 10:43258678-43258700 GCTCCTAGGGGCTGGCCTGTGGG - Intronic
1069617721 10:69816810-69816832 TCCCCTAAGAACTGTCCTGCAGG - Intronic
1071194367 10:83140610-83140632 TTTCCTAGAATCTGTCCTGGGGG - Intergenic
1074716084 10:116220567-116220589 ACTCCTGGGAGCTGTCCTGATGG - Intronic
1075168302 10:120089526-120089548 TCACCTAAGAGCTCTCATGGAGG + Intergenic
1076717571 10:132374262-132374284 TCTCCTGGGACCTGCACTGGAGG + Intronic
1077516028 11:3002688-3002710 TCTCCTAGGGCCTGGCATGGAGG + Intronic
1081277825 11:41171890-41171912 TTTCCCAGCAGCTGGCCTGGTGG - Intronic
1083147088 11:60767753-60767775 TCTCCTAGGTGGGGGCCTGGAGG + Intronic
1083274411 11:61588544-61588566 AGTCCTCGGAGCTCTCCTGGAGG + Intergenic
1084105791 11:66979455-66979477 TCAGCTAGGAGCTGGGCTGGGGG - Intergenic
1084301686 11:68256529-68256551 TGGCCTTGGATCTGTCCTGGGGG + Intergenic
1084658597 11:70534070-70534092 TCTGCTAGGCGCTGCCCTAGAGG + Intronic
1084719164 11:70893029-70893051 TCCCCTAGAAGCTGACCTTGAGG - Intronic
1084939252 11:72603545-72603567 GCTCCGAGGAGCCTTCCTGGAGG + Intronic
1091399055 12:171797-171819 TGTCCTGAGGGCTGTCCTGGGGG + Intronic
1092758797 12:11790505-11790527 TCTTCTAGTAGCCATCCTGGAGG + Intronic
1095294207 12:40509962-40509984 TGTGCCAGGAGCTGCCCTGGTGG - Intronic
1096071637 12:48778617-48778639 TCTCCTGGGTGCTGTCCTTAAGG - Intronic
1100257114 12:92895564-92895586 TCACCCAAGAGCTCTCCTGGAGG + Intronic
1101334597 12:103785074-103785096 CCTGCTAGGAGCTCTCCTGTGGG - Intronic
1102007362 12:109597130-109597152 TCCCCCAGGGGCTGTCCCGGAGG + Exonic
1102876963 12:116456531-116456553 CCTCCCAGGCTCTGTCCTGGTGG + Intergenic
1103209379 12:119155361-119155383 TCTCCCTGGAGATGACCTGGAGG + Intronic
1103403471 12:120659003-120659025 TCTCCAAGGAGCAGGCCTGGAGG - Intronic
1105063299 12:133173367-133173389 TCCCCTTGGTGCTGTCCTTGAGG + Intronic
1105215142 13:18279813-18279835 TCCCCCAGGAACTGTGCTGGAGG - Intergenic
1106433497 13:29704250-29704272 TCTCCTACCAGTAGTCCTGGAGG - Intergenic
1106450531 13:29877866-29877888 TCTCCTAGGCGTTGTCGGGGAGG - Intergenic
1106947216 13:34842121-34842143 TCCCCTTGGTGCTGTCCTTGTGG + Intergenic
1110585405 13:77185201-77185223 TCTTCTAGAAGCTGTCCTTCAGG - Exonic
1112397671 13:99047953-99047975 ACTCCTAGGAGCTCTGCTGTTGG - Intronic
1113784096 13:112993386-112993408 TCTCCTAAAAGCCCTCCTGGCGG - Intronic
1113914572 13:113863035-113863057 TCTGCCAGGTGCTCTCCTGGAGG - Intronic
1114578055 14:23731156-23731178 TCTGTTATGAGCTGTCCAGGGGG - Intergenic
1117690106 14:58297985-58298007 ACGACTAGGTGCTGTCCTGGAGG + Intronic
1122767532 14:104082369-104082391 TCTCCTTGGACCTGCCCAGGTGG + Intergenic
1122814857 14:104307372-104307394 TCTCCTGGGAGCTGCCCTGTTGG + Intergenic
1122817932 14:104322998-104323020 CCGCCTTGGTGCTGTCCTGGAGG - Intergenic
1123145215 14:106123111-106123133 TCACCAATGAGCTGTGCTGGTGG - Intergenic
1124414797 15:29466377-29466399 TCTCCTGGGCTCTCTCCTGGGGG - Intronic
1124414947 15:29466771-29466793 TCTCCTGGGCCCTCTCCTGGGGG - Intronic
1124883426 15:33662369-33662391 TCTCCTTGGCGCTGGCCAGGTGG - Exonic
1124948368 15:34292515-34292537 TCTCTTCAGAGCTGTCCAGGAGG + Intronic
1125099498 15:35894699-35894721 TCACCTAGGAGCTCTGATGGAGG - Intergenic
1127032977 15:54884409-54884431 TGTACTAAGAGCTGTCCTGGAGG - Intergenic
1127393964 15:58528822-58528844 TCTTCTGGCAGCTGACCTGGAGG + Intronic
1129978675 15:79846350-79846372 CCTCCTGACAGCTGTCCTGGGGG + Intronic
1131308134 15:91264015-91264037 TGTCCCAGGAGCAGTCCTGCTGG + Intronic
1132359668 15:101201865-101201887 TCTCCCAGTAGGTGTCCAGGAGG + Intronic
1132552665 16:559914-559936 GCCCCTGGGGGCTGTCCTGGGGG - Intergenic
1132792419 16:1699137-1699159 TCTCCAAGCAGCTGTCATGACGG - Exonic
1135755323 16:25092544-25092566 TTTCTGAGCAGCTGTCCTGGTGG + Intergenic
1137440709 16:48496783-48496805 CCTCACAGGAGCTGTCCAGGTGG + Intergenic
1137847854 16:51709632-51709654 TCTGTTTGGAGCTGGCCTGGAGG + Intergenic
1138460127 16:57143126-57143148 TCCCCTTTGATCTGTCCTGGGGG + Intronic
1140482856 16:75271835-75271857 TTTCCCAGGAGCTGACATGGGGG + Intergenic
1141663184 16:85452715-85452737 TCTCCCAGGACCTGTGCTGAGGG - Intergenic
1141718598 16:85741826-85741848 TGTCCCAGGCCCTGTCCTGGAGG - Intronic
1142249959 16:88986684-88986706 TCTCCCTGGAGCTGACCTAGCGG - Intergenic
1142518517 17:489538-489560 TCTCCCAGGAGGCGTCCTGCTGG - Intergenic
1146716218 17:35089118-35089140 TCTCCTAGGTGCCGGCCGGGAGG - Exonic
1147299316 17:39511569-39511591 TCTCCTAGCAGTAGTTCTGGAGG - Exonic
1147597133 17:41724494-41724516 TCTCCTGGGGGCTGGGCTGGGGG - Exonic
1147620740 17:41865122-41865144 ACTGCTCAGAGCTGTCCTGGCGG - Exonic
1148339498 17:46864873-46864895 GCTCCTGGAAGGTGTCCTGGAGG - Intronic
1148542726 17:48493073-48493095 TCTCCTGACAGCTTTCCTGGAGG - Intergenic
1150331319 17:64296694-64296716 GCTCATGGGAGCTGTCTTGGGGG - Intergenic
1152689893 17:81713105-81713127 TCTCCTGGCATCTCTCCTGGGGG - Intronic
1152859163 17:82685547-82685569 GCCCCTAGGACCTGCCCTGGAGG - Intronic
1153527564 18:6012240-6012262 TATCCTAAGAGCTGTCAGGGAGG + Intronic
1155353350 18:24927921-24927943 TCTTCTGGCAGCTTTCCTGGTGG - Intergenic
1155582784 18:27329494-27329516 TCTCCCATCAGCTGTTCTGGAGG + Intergenic
1155930398 18:31701205-31701227 TCTCCTTGGTGCTGTTCTTGTGG + Intergenic
1157682688 18:49619328-49619350 TCTCTTCGGAGCACTCCTGGAGG + Intergenic
1157936155 18:51874917-51874939 TCAACTAGGTGCTGTCATGGGGG + Intergenic
1161051403 19:2165530-2165552 TGTCCTAGGACCTCTCCTGGCGG - Intronic
1161950885 19:7467225-7467247 TCTCCACATAGCTGTCCTGGTGG - Exonic
1163218538 19:15897927-15897949 GCTCCTGGGTGCTGGCCTGGAGG - Intronic
1163382317 19:16977295-16977317 TCTCCAAGGTGCTGGCCAGGGGG - Intronic
1165079322 19:33298571-33298593 CGTCCTAGGACCTGTTCTGGGGG + Intergenic
1167291965 19:48629449-48629471 CCACCTAGGCGCTGACCTGGTGG + Exonic
1167333973 19:48873395-48873417 TCTGGTAGAAGCTGGCCTGGAGG + Exonic
1168089051 19:54070062-54070084 TATCATGGGAGCTTTCCTGGTGG - Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925282115 2:2691858-2691880 TTGACTCGGAGCTGTCCTGGAGG - Intergenic
925385546 2:3459469-3459491 TCCCCTGGGAGCTGCCCTGGGGG - Intronic
926171941 2:10558127-10558149 TTTCCTGGGAGCTGAGCTGGAGG - Intergenic
927236676 2:20881240-20881262 TGTCCCAGGAGCCATCCTGGAGG + Intergenic
927238768 2:20901787-20901809 TCTCCTATTATCTGTCCTGGGGG - Intergenic
927847780 2:26480260-26480282 TCTCTTTGGAGCCTTCCTGGAGG - Exonic
928242969 2:29602460-29602482 TCTCCAAGCAGGTGGCCTGGTGG - Intronic
929111379 2:38407823-38407845 TCTTCCAGGAGTTGGCCTGGAGG - Intergenic
930313583 2:49771585-49771607 TCTCCTGAGAGCTGTTCTGTTGG - Intergenic
932214699 2:69959139-69959161 TCCCTCAGGAGCTGTCCAGGTGG + Intergenic
934299177 2:91766924-91766946 TCCCCCAGGAACTGTGCTGGAGG + Intergenic
934755651 2:96822956-96822978 GCTCCTTGGAGCTGGCCTGTGGG + Intronic
935115358 2:100130767-100130789 TCTCTGTGGGGCTGTCCTGGAGG - Intronic
935857323 2:107289108-107289130 TCTCACAGGAGCTGTCCCAGTGG - Intergenic
936690767 2:114885322-114885344 TCCCCTCGGCGCTGTCCTCGTGG - Intronic
938798426 2:134738176-134738198 TCTCCTTGCAACTGTCCTGATGG - Intergenic
941883384 2:170504093-170504115 TCTACTAGGAAATGTCCTAGTGG - Intronic
942912629 2:181264308-181264330 CTTTCTAGGAGCAGTCCTGGGGG + Intergenic
945738458 2:213630993-213631015 ACTCTTAGGAGGTGCCCTGGAGG + Intronic
946975831 2:225149052-225149074 TCTACTAGCAGCTGTCCTTTTGG + Intergenic
1169143247 20:3237810-3237832 TCTGCTAGGGGCTGCCCAGGCGG + Intronic
1171298565 20:24039866-24039888 GGTCCTAGGGGCTGTCCTAGAGG + Intergenic
1171355726 20:24544243-24544265 TCTCACCGGTGCTGTCCTGGGGG - Intronic
1172214147 20:33223125-33223147 ACTCCAAGGTGCTGTCTTGGAGG + Intronic
1172603987 20:36202376-36202398 TCTCCGAAGGGCTGGCCTGGAGG - Intronic
1173736711 20:45366982-45367004 TCCCCTCGGCGCTGACCTGGTGG + Exonic
1175702106 20:61147087-61147109 TCACCTAGGAGCTGACCCTGTGG - Intergenic
1176287544 21:5026425-5026447 TTTCCAAGGAGCTGTTCTGTGGG - Exonic
1176385542 21:6137177-6137199 CCTCCTCGGAGCTGTTCTGGGGG + Intergenic
1179456407 21:41503970-41503992 TTTCCAAGGGGCTGTCCTGGCGG - Intronic
1179594180 21:42431041-42431063 GCTCCACGCAGCTGTCCTGGTGG + Intronic
1179709802 21:43206786-43206808 TCTCCTACAAGCTGACCTAGTGG + Intergenic
1179737931 21:43401075-43401097 CCTCCTCGGAGCTGTTCTGGGGG - Intergenic
1179869637 21:44237050-44237072 TTTCCAAGGAGCTGTTCTGTGGG + Exonic
1181463706 22:23099617-23099639 CCTCTCAGGAGCTGTCCTTGTGG - Intronic
1181617189 22:24062961-24062983 TCTCCTCGGAACTGCCCTGCTGG + Exonic
1181806387 22:25376889-25376911 TCTCCTGGCAGCTGTGCTGAGGG - Intronic
1182504563 22:30772582-30772604 TGTCCTAGGAGCAGCCCTGCTGG + Intronic
1183020319 22:35021440-35021462 TCCCCATGGAGCTGTCCCGGTGG + Intergenic
1183279750 22:36925668-36925690 TCTCTAAGGAGGTGACCTGGGGG - Intronic
1183978052 22:41524565-41524587 TCTCCTCACAGCTATCCTGGAGG - Intronic
1184426629 22:44412485-44412507 CCTGCTAGGACCTGTCCTGCAGG + Intergenic
950027896 3:9833267-9833289 TTTCCTAGAAGCTGACCTGTGGG - Intronic
952499965 3:33951964-33951986 TCACTTGGGAGCTGGCCTGGAGG + Intergenic
952512201 3:34069045-34069067 TCTGCTAGGAGCAGACCTTGCGG + Intergenic
954384795 3:50238372-50238394 GCTCCAAGGAGCAGGCCTGGTGG - Intronic
954692266 3:52401873-52401895 TCTCCTAGGAGCTGTCCTGGTGG - Exonic
954902579 3:54032334-54032356 TCTGCCAGGAGCTGTCTTGCTGG + Intergenic
955337231 3:58096840-58096862 TCTCCTTGGAGGTGCTCTGGAGG + Intronic
956716802 3:72086643-72086665 TCTCCAAGTAGCTGTCCGTGAGG - Intergenic
960265422 3:115615706-115615728 ACTCCTAGCACCTGGCCTGGTGG - Intergenic
961554806 3:127690509-127690531 TCTCCCAGGCCCTGTTCTGGAGG - Exonic
961643388 3:128379199-128379221 TCTCCTGGAAGCCGTCCTGACGG + Intronic
961815701 3:129549044-129549066 TCTCCTGGGAGCCGTCGCGGGGG - Exonic
964087734 3:152836795-152836817 TCTTCTAGAAGCTTTCCTTGTGG - Exonic
965255598 3:166405620-166405642 TCACCCAAGAGCTGTCATGGAGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
970168068 4:13261119-13261141 TATCCAAGGAACTGCCCTGGAGG + Intergenic
973735632 4:53868997-53869019 TGTGCCAGGTGCTGTCCTGGGGG - Intronic
975990915 4:80259176-80259198 TAACTTAGGAGCTGTCATGGGGG - Intergenic
977137162 4:93319727-93319749 TCTCCTAGCGCCTTTCCTGGAGG - Intronic
977779050 4:100958641-100958663 TCTCCCTGGTGCTGTCCTTGTGG - Intergenic
980593975 4:134928596-134928618 TCTCTTTGGAGCTGTCAGGGAGG + Intergenic
981147605 4:141343405-141343427 GCTCCGAGGAGCTGTCATGAAGG + Intergenic
982388380 4:154837383-154837405 TCTCCTATGGCCTGTCCTTGGGG + Intergenic
985215048 4:187643190-187643212 TCAACTATGATCTGTCCTGGAGG - Intergenic
985821935 5:2166427-2166449 TCTCCAAGGAGTCCTCCTGGAGG - Intergenic
988835767 5:35030768-35030790 TCTACTAGGCTCTGTGCTGGTGG + Intronic
989111032 5:37906847-37906869 GCTCCTTGGTGGTGTCCTGGGGG + Intergenic
992553346 5:77880256-77880278 TCTGCCAGGGGCTGCCCTGGGGG + Intergenic
996759965 5:126976927-126976949 GCTCCTAGGAATTGTCTTGGAGG - Intronic
997284450 5:132668182-132668204 TCTCCTGGGTGCTGGCCTGCAGG + Intergenic
997824628 5:137095644-137095666 TGTCATAGGAGCAGTGCTGGTGG - Intronic
999614396 5:153406695-153406717 ACTCCAAGAAGCAGTCCTGGTGG - Intergenic
1001197614 5:169687725-169687747 TCTCCTAGCAGCCGTCATGCTGG - Intronic
1001246901 5:170111609-170111631 TCTCCCAGCAGCTTCCCTGGCGG + Intergenic
1002437086 5:179238322-179238344 TCTCCCAGGAGCAGTCCCTGAGG - Intronic
1003306225 6:4932011-4932033 TCTCCCAGCAGTTTTCCTGGTGG - Intronic
1004739640 6:18446325-18446347 TCTTCTAGGAGCTGAGCTGAAGG + Intronic
1005840748 6:29743338-29743360 TCCTCCAGGAGCTGTCTTGGGGG - Intergenic
1007104893 6:39276908-39276930 TCCACTGAGAGCTGTCCTGGCGG - Intergenic
1009930348 6:70170255-70170277 TCTCCCACCAGCTGTCCTGTAGG + Intronic
1012925304 6:105261616-105261638 TCTATTGAGAGCTGTCCTGGTGG + Intergenic
1013748715 6:113376061-113376083 TCTCCTAGGAGCTGTTGCTGTGG + Intergenic
1017854984 6:158342998-158343020 TCACCCGGGGGCTGTCCTGGTGG - Intronic
1018571822 6:165219749-165219771 TCTGCTAGGAGTTTTCCTGAAGG - Intergenic
1019167290 6:170107133-170107155 TCACCAAAGAGGTGTCCTGGGGG - Intergenic
1019463957 7:1176234-1176256 TGTCCCGGAAGCTGTCCTGGCGG - Intergenic
1019842656 7:3463805-3463827 CCTCCTATGGCCTGTCCTGGAGG - Intronic
1024006726 7:45229767-45229789 TCTCCCAGGAGGTGGCGTGGTGG - Intergenic
1024541637 7:50479721-50479743 TCCCCTCAGAGCTGCCCTGGAGG - Intronic
1025611184 7:63076942-63076964 TGTCCTGGGAACTGTCCTTGAGG - Intergenic
1025708389 7:63887146-63887168 TCTCCTGGGAACTGTCCTTGAGG + Intergenic
1026468980 7:70678415-70678437 TCTCCTTGGAGTGGTACTGGGGG + Intronic
1026510865 7:71026488-71026510 TCTCCCAGGAACAGTACTGGGGG - Intergenic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1029459000 7:100684849-100684871 CCTCCAAGGAGCTGTCCTGCAGG + Exonic
1029508107 7:100975064-100975086 TCTGGGAGGAGCTGTCCTGGTGG + Intronic
1029616918 7:101664961-101664983 TTTCCTAGGAGGTGTCCAGGGGG - Intergenic
1029927053 7:104329030-104329052 TCTCCCGGGAGCTGACCTGCAGG + Exonic
1033856769 7:145571667-145571689 TCTTCTAGGTGCTGTACTTGTGG - Intergenic
1034193643 7:149229515-149229537 TCTCCTAGGGCCTGTGCTGGGGG - Intergenic
1041944371 8:63424780-63424802 TCTCTTAAGAGCTGTCCGGCAGG - Intergenic
1041948638 8:63475341-63475363 TCTCCTTGCATCTTTCCTGGTGG - Intergenic
1043388046 8:79767627-79767649 TGTCCGAGGAGCTGTACTCGGGG + Exonic
1044219341 8:89650416-89650438 TCTGCTAGGAGCAGCCCAGGAGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045618262 8:103942881-103942903 TCTCCATGGAGCTGTCTTCGTGG - Exonic
1047596574 8:126383697-126383719 TCTCCTTCTAGCTGTCCTAGTGG + Intergenic
1049257053 8:141619788-141619810 TCTCTTGGGAGGGGTCCTGGAGG - Intergenic
1049311145 8:141934592-141934614 TGTCCTAGATGCTGTCCTTGTGG - Intergenic
1053466359 9:38311522-38311544 GCTGCCAGGAGCTGTCCTGAAGG - Intergenic
1054814904 9:69465702-69465724 TCTCCACGGAGTTGTCCTGTTGG + Intronic
1055670028 9:78595349-78595371 TCTACTAGGCACTGTCCTAGTGG - Intergenic
1060024932 9:120162839-120162861 TCTCCTTAGAGCAGCCCTGGAGG - Intergenic
1061726899 9:132587087-132587109 TCTCCCCGGAGCTGCCCGGGGGG + Intronic
1061822846 9:133238343-133238365 CCTGCCAGGAGCTGGCCTGGAGG - Intergenic
1062068116 9:134539863-134539885 TCTTCTGGGACCTCTCCTGGGGG + Intergenic
1062596914 9:137303676-137303698 TCTCCCAGGAGCTCTCAAGGGGG + Intergenic
1062667211 9:137681208-137681230 TCCCCGGGGAGCTGTCCTGCTGG + Intronic
1187556449 X:20356723-20356745 TCTCCTAGACTCTGTCCTTGGGG - Intergenic
1189086848 X:38034521-38034543 TCTTCTCGCAGCTGTGCTGGAGG - Intronic
1192845325 X:74901318-74901340 TCTCCTAGGTTGTTTCCTGGAGG + Intronic
1195240753 X:102949686-102949708 TCTCTACAGAGCTGTCCTGGGGG - Intergenic
1200325054 X:155229126-155229148 TCCCCTAGCTGCTGTCCTGTAGG + Intronic
1201595757 Y:15667091-15667113 TCTCCTAAGAGCTCTTCTGTTGG + Intergenic
1202021443 Y:20468808-20468830 TCTTCTAGGAGGTGTGCTGTGGG - Intergenic