ID: 954693178

View in Genome Browser
Species Human (GRCh38)
Location 3:52406639-52406661
Sequence GCCTGTGGCCTGCTCCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 2, 2: 6, 3: 42, 4: 413}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954693178 Original CRISPR GCCTGTGGCCTGCTCCTGGG TGG (reversed) Intronic
900124635 1:1064005-1064027 GCCTCCTGCCGGCTCCTGGGTGG + Intergenic
900179450 1:1304873-1304895 CCCTGTTGCCTGCTCCCGGAGGG - Intronic
900490173 1:2944089-2944111 CCCTGTGTCCTGCTCCAGGCTGG + Intergenic
900952403 1:5865387-5865409 TCCTGTGGCCTGGTCCTCTGGGG - Intronic
901104717 1:6746250-6746272 GCCTTTGGCGTGCTTCTGGTTGG - Intergenic
903052655 1:20613108-20613130 GCATGTGTCCTGGTCCTTGGAGG - Intronic
903386962 1:22933294-22933316 GGCTGTGGCCTCCAGCTGGGAGG - Intergenic
903857055 1:26343749-26343771 GCCTGTTCCCTGCCCCTGGAGGG - Exonic
905184782 1:36188396-36188418 GCCTGTGGTCTGGTCCATGGTGG - Intergenic
905274884 1:36810903-36810925 GCCTGAGGCTTGCTTGTGGGGGG + Intronic
905308299 1:37033751-37033773 GCCCTTGGCGCGCTCCTGGGAGG - Intronic
905794799 1:40809620-40809642 GACTGTGGCCTGGCCCAGGGTGG - Intronic
906557004 1:46721890-46721912 GCCAGTGGGCTGGTCATGGGTGG + Intergenic
907989348 1:59564472-59564494 GGGTGTGGCCTGGGCCTGGGGGG + Intronic
912390646 1:109300360-109300382 GACAGTGGCCTGCCCCTGGAGGG + Intronic
912488574 1:110048457-110048479 CCCTGAGCCCAGCTCCTGGGTGG + Intronic
913093773 1:115497372-115497394 GCCTCTGTCCAGTTCCTGGGAGG - Intergenic
915913672 1:159929064-159929086 GCCTGACGCTGGCTCCTGGGAGG - Intronic
919912878 1:202122807-202122829 GCCTGTGGCCGGAGGCTGGGAGG + Intergenic
919922031 1:202171713-202171735 GCCTGGGGCCCGCTACTGTGTGG + Intergenic
921163717 1:212491063-212491085 GCCTCTGCCCGGCTCCTGGCTGG + Intergenic
922041790 1:221904263-221904285 GCCTGGGTCCTGCACCTGAGAGG + Intergenic
922505276 1:226122300-226122322 GCCTCTGGCCTTCGCCTGGAAGG - Intergenic
924135328 1:240960057-240960079 GGCTGTGGCTTGAGCCTGGGAGG + Intronic
1062905682 10:1178162-1178184 GCCTGAGACCTCCTCCTGGGTGG + Exonic
1062980573 10:1718756-1718778 GCCTGGAGCCCCCTCCTGGGAGG - Intronic
1063388429 10:5632064-5632086 GCTTGTGGCGTGCTCCCAGGTGG - Intergenic
1067096920 10:43307549-43307571 GCGCCTGACCTGCTCCTGGGAGG + Intergenic
1067473493 10:46551917-46551939 GCCTGTGGCCTGCTCCCCTCTGG + Intronic
1068083498 10:52347336-52347358 GCCTGGGTCCTGCACCTGGGAGG - Intergenic
1068746203 10:60533350-60533372 CCCTCTGTCCAGCTCCTGGGAGG - Intronic
1069773478 10:70913720-70913742 GGCTGTGGCCTGATCCATGGGGG + Intergenic
1070450642 10:76553900-76553922 GTCTGTGGGCTGCTCCAGGAAGG - Intronic
1072154805 10:92714842-92714864 GCCTGGGTCCTGTGCCTGGGAGG + Intergenic
1072436190 10:95416436-95416458 GCATGTGGCCTGCTACGGGCTGG - Intronic
1073379811 10:103069535-103069557 GCCTGTGGCCGGCTCTTGTCTGG + Intronic
1074160607 10:110833714-110833736 GGCTCTGGCCTGCTGCGGGGAGG - Intronic
1075840071 10:125493997-125494019 GCCTGGGCCATGCTCCTGGAGGG + Intergenic
1077010260 11:376483-376505 GACTGGGGGCCGCTCCTGGGCGG - Exonic
1077124017 11:924670-924692 TCCTGTGCCCTCCTCCTGGCCGG + Intergenic
1077133537 11:987085-987107 GCCTGTCACCTACTCTTGGGAGG + Intronic
1077160028 11:1108442-1108464 GCCTGGGGCCTCCTCCAGGTGGG + Intergenic
1077200558 11:1305319-1305341 TCTGGTGGGCTGCTCCTGGGAGG - Intronic
1077338919 11:2017460-2017482 GCCTGTTTGCTGCTCCTGGGAGG + Intergenic
1078729777 11:13963903-13963925 GCCCGAGGCCTGCTCCCTGGAGG + Intronic
1079991235 11:27249043-27249065 CCCTGAGGCCTGGTCCTCGGTGG - Intergenic
1081607875 11:44538476-44538498 GCCTGTGGCCTGCTCTGGTGAGG + Intergenic
1082807155 11:57458634-57458656 GACTAGGGCCTGCGCCTGGGGGG - Intergenic
1083041077 11:59688142-59688164 CCCTGTGGCCTGCTCTCTGGGGG - Intergenic
1083487807 11:62994577-62994599 GCCGCTGCCCTGCTCCTGGCAGG - Exonic
1084276077 11:68051585-68051607 GGCTGAGGCCAGCTGCTGGGAGG + Intergenic
1088400513 11:109418701-109418723 TCCTGTAGACTGCTCCTGGTTGG + Intergenic
1088595177 11:111435746-111435768 GGCTGTGGCCTCACCCTGGGGGG - Intronic
1089169183 11:116500465-116500487 GACTGTGGCCTGCGCCGGGCCGG - Intergenic
1089171871 11:116517688-116517710 CCCTGTGGCTGGCTCCTGGCCGG - Intergenic
1089526544 11:119100971-119100993 GCCTGTGGCTGGGACCTGGGAGG - Intronic
1089684666 11:120139118-120139140 GCCTGTGGCCTGGCCCAGAGAGG - Intronic
1089822609 11:121241729-121241751 GCCTGAGTCCTGCACCTGGGAGG + Intergenic
1089823096 11:121246373-121246395 GCCCGAGTCCTGCACCTGGGAGG - Intergenic
1202821903 11_KI270721v1_random:72642-72664 GCCTGTTTGCTGCTCCTGGGAGG + Intergenic
1094425213 12:30310108-30310130 GCCTCTGTGCTGCTCCTGGGTGG - Intergenic
1095583196 12:43823597-43823619 GCCTGAGGCTTGAACCTGGGAGG - Intergenic
1096524987 12:52205156-52205178 GCCTGCAGGCCGCTCCTGGGTGG - Intergenic
1096602793 12:52742287-52742309 GCCCAGGTCCTGCTCCTGGGAGG - Intergenic
1102503895 12:113371885-113371907 GCCTGTGGCCTTCTTGTGGGTGG + Intronic
1102784852 12:115596077-115596099 GCCTGAGTCCTGCTCCAGGGTGG + Intergenic
1103096437 12:118136388-118136410 GCCTGTGCCGGCCTCCTGGGTGG + Intronic
1103132306 12:118479844-118479866 GGCTATGGGCTGCTCCTGAGAGG + Intergenic
1103509110 12:121462100-121462122 GCCTGTGGCCTTCCCTTGTGGGG - Intronic
1103961505 12:124611745-124611767 CCCTGGGGCCTGCCTCTGGGAGG + Intergenic
1104885313 12:132104068-132104090 GCCTGGGGCCTGCCCCGGCGCGG + Exonic
1104944473 12:132409513-132409535 GCCTGTGGGGGGCTTCTGGGCGG + Intergenic
1104964543 12:132503022-132503044 GGCTGTGGCCTGGCCCTGTGCGG - Intronic
1105247400 13:18665940-18665962 CCCTGTGACCTGCTCCTGGCCGG - Intergenic
1105325933 13:19370639-19370661 GGATGTGGGCTGCTCCGGGGAGG + Intergenic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1105704986 13:22963045-22963067 TCCTGTGCCCAGCTCCTGGTTGG - Intergenic
1105827727 13:24137296-24137318 GCCAGGGGCCTGCTCCTGGCTGG + Intronic
1105867574 13:24474455-24474477 GGATGTGGGCTGCTCCGGGGAGG - Intronic
1106569064 13:30910698-30910720 AGCTGTGACCTGCTCCTGGATGG + Intronic
1108059370 13:46517396-46517418 GCCTGGGACCTGCTCCAAGGGGG + Intergenic
1108088205 13:46818168-46818190 GCCCGGGTCCTGCGCCTGGGAGG - Intergenic
1108479664 13:50856041-50856063 GGCTCTGTGCTGCTCCTGGGTGG - Intergenic
1109559585 13:64029557-64029579 GTCAGTGGCCTGCTCGTCGGTGG - Intergenic
1110008123 13:70297434-70297456 GCCTGGGTCCTGCACCTGGGAGG - Intergenic
1113430572 13:110246848-110246870 GCCTGTGTTGTGCTCCTGTGAGG + Intronic
1113574572 13:111385617-111385639 GCCTGGGGCCTGCTCCCGTACGG - Intergenic
1113682792 13:112255911-112255933 GGCTGTGGACTGGCCCTGGGCGG - Intergenic
1113710905 13:112464692-112464714 TCCTGTGCCCTGCTGTTGGGTGG - Intergenic
1114363590 14:22003054-22003076 GCCTGTGGCCTGATCTTGTAGGG + Intergenic
1116908883 14:50436281-50436303 GTCTCTGTCCTGCTTCTGGGAGG + Intronic
1117081729 14:52158483-52158505 GTCTGTTGGCTGCTACTGGGAGG - Intergenic
1118213652 14:63788284-63788306 GCCTGGGTCCTGCACCTGGGAGG + Intergenic
1118615129 14:67569811-67569833 GTCACTGGCCTGCTCCTGGAGGG + Intronic
1118913363 14:70080337-70080359 GGCTGTGGACTGTTCCTGGCTGG + Intronic
1119910457 14:78345145-78345167 GCCTGTGGCCCACACTTGGGGGG + Intronic
1121017283 14:90556410-90556432 GCTTGGGTCCTGCTGCTGGGGGG + Intronic
1122157006 14:99755872-99755894 GCCAGGGACCTGCTCCAGGGTGG - Intronic
1122505618 14:102229980-102230002 GCCTGTCGCCTGGTTTTGGGTGG + Intronic
1122901963 14:104785743-104785765 GGCTGAGGCCTGCTCCATGGTGG - Intronic
1122987291 14:105218354-105218376 GCCTGGGACGTGCTGCTGGGTGG + Intronic
1123030609 14:105449511-105449533 GCCTGTGCCCTGCGCCCGGCCGG + Intronic
1123121488 14:105918954-105918976 GCCTGTGGCCTGGTCGAGGTTGG + Intronic
1123922368 15:25079358-25079380 ACCTGTAGCCTGCCTCTGGGTGG + Intergenic
1124971850 15:34496115-34496137 GGCTGCGGCCTGGCCCTGGGAGG + Intergenic
1125724322 15:41860637-41860659 GCCCGCGGCCTGCACCAGGGTGG - Exonic
1125807330 15:42505182-42505204 GTCTGTGGCTTGAGCCTGGGAGG - Intronic
1126713244 15:51484209-51484231 CCCTGTGGGCTGCTTCTGGCAGG + Intronic
1128769739 15:70273047-70273069 GCCTGGGGCTTGTTCCGGGGTGG + Intergenic
1129369280 15:75078205-75078227 GCCTGAAGTCTGGTCCTGGGAGG + Intronic
1129413510 15:75362348-75362370 GCCTGTGGGGGGCACCTGGGTGG - Exonic
1129718568 15:77865582-77865604 GCTTCTGGCCTGCTCCAGAGTGG + Intergenic
1130337902 15:82973288-82973310 GCCTGTGCCCTGCCCATGGAAGG - Intronic
1130460360 15:84155284-84155306 GCTTCTGGCCTGCTCCAGAGTGG - Intergenic
1131225880 15:90624116-90624138 GCCAGTGGCTGGCCCCTGGGAGG + Intronic
1131341753 15:91608879-91608901 GCCTGTGCCCTGCTCAGGTGTGG - Intergenic
1131387402 15:92018703-92018725 ACCTGTGGGCTGCACCTGAGTGG + Intronic
1131482968 15:92797809-92797831 GGCTGGGGCCTGCTGCTGGAGGG + Intronic
1131990056 15:98084344-98084366 GCCAGCGGCCAGCTGCTGGGAGG + Intergenic
1132214911 15:100055354-100055376 GCTTGTGGCCTGCTCCAGCCTGG - Intronic
1132241966 15:100265142-100265164 GCCTGTGGTCGGCACCTGGCAGG - Intronic
1132574421 16:657970-657992 GCCTGGGTCCTGCTCCCGAGTGG - Intronic
1132689708 16:1177021-1177043 GCCTGGGGGAAGCTCCTGGGGGG - Intronic
1132693996 16:1194086-1194108 GCCTGTGGTCTGCGCCAGGTGGG + Intronic
1132694193 16:1194769-1194791 GCCTGGGGCCTGCGCCTGGCCGG - Intronic
1132728648 16:1349884-1349906 GCCTGTGGCCAGCACCCGGTAGG - Exonic
1132765436 16:1532100-1532122 GCCTGTGCCCTGCTCCTCGGAGG - Intronic
1134059036 16:11188031-11188053 GCCTTGGGACTGGTCCTGGGAGG + Intergenic
1134090550 16:11389328-11389350 GCCTGTGGCCAGCTTCTGCACGG + Intronic
1134681843 16:16131816-16131838 ACCTGGGGCCAGCTGCTGGGCGG - Exonic
1134691333 16:16192616-16192638 GCCTGTGGCCTGAACATTGGAGG + Intronic
1135296507 16:21283833-21283855 GTCTGTAGCCTGATCCTGCGCGG - Intronic
1136579608 16:31143430-31143452 GCCAGGGGCCTGGCCCTGGGAGG - Exonic
1136651555 16:31677488-31677510 GCCTGTGGGCTGCCCCGGGAAGG + Intergenic
1138436014 16:57000459-57000481 GCCTCAGGCCTGAGCCTGGGTGG - Intronic
1138594097 16:58020331-58020353 GGCTGGGGCCTCCTACTGGGAGG - Exonic
1139436390 16:66939055-66939077 GCCTGTGGCCTGTAACTTGGTGG + Intronic
1140807364 16:78545322-78545344 GATTGTGGCCTGCTCCTCGTGGG + Intronic
1141510534 16:84509253-84509275 ACCTCTGACCTGCTGCTGGGAGG - Intronic
1141578453 16:84981029-84981051 GACAGTGCCCTTCTCCTGGGGGG - Intronic
1141604667 16:85145940-85145962 GCCTGGAGTCTGCTCCCGGGAGG + Intergenic
1141682053 16:85550582-85550604 GGTTGTGGCCTGGTCCTGGGGGG + Intergenic
1142080053 16:88144124-88144146 GCCTCTGCCCTGCTCCGGGACGG - Intergenic
1142143520 16:88483099-88483121 GCCTGGGGCTGGCTCCTGTGTGG + Intronic
1142144035 16:88485254-88485276 GCCTGTCCCCTGGTGCTGGGGGG + Intronic
1142233107 16:88909035-88909057 GCCTGTGGTCAGCTCCAGGAAGG - Intronic
1142287365 16:89176913-89176935 GCCTGAGGGCTTGTCCTGGGTGG + Intronic
1142292510 16:89199519-89199541 GCCTGTGGTCAGCACCAGGGAGG + Exonic
1142423341 16:89987045-89987067 GCCTGTGGTCTCCTGCTGGATGG + Intergenic
1142582730 17:952125-952147 TCCTGTGGCCTTGTCCTGGCAGG - Intronic
1143225894 17:5302650-5302672 GCCTGTCGCTTGCGCCTGGGAGG - Intronic
1143532733 17:7514453-7514475 GCCTGTGGCTTGATGCGGGGCGG + Exonic
1144777986 17:17794446-17794468 GACTGTGGCGTGCTGCTCGGCGG - Exonic
1145018807 17:19414831-19414853 GCCTCTTGCCTGCCCCAGGGAGG + Exonic
1145234269 17:21197747-21197769 GCCAGGAGACTGCTCCTGGGCGG + Exonic
1145981051 17:29011811-29011833 TCCTGTGGGCTGCCCCTGGCAGG + Intronic
1147602044 17:41752796-41752818 ACCTCTGGCCTGATACTGGGAGG - Intergenic
1148640506 17:49183868-49183890 GCCTAGGTCCTGCACCTGGGAGG + Intergenic
1148919538 17:51018606-51018628 GCATGTTTCCTGCTGCTGGGTGG - Intronic
1149023807 17:52001153-52001175 GCCTGAGGCCTGTTTCTGTGTGG + Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1151803107 17:76389226-76389248 TCCTCTGGCCTCCTCCTGGCCGG - Intergenic
1152293571 17:79454211-79454233 GCCTGGGGCATGCGGCTGGGTGG - Intronic
1152643386 17:81458237-81458259 CCCTGGGGCCCGCTCCAGGGTGG - Exonic
1152716743 17:81903941-81903963 GCCTCTGGGCTGCTCCAGGCGGG + Intronic
1153573252 18:6494840-6494862 GCCAGTGGAGTGCCCCTGGGAGG + Intergenic
1154021544 18:10668078-10668100 GCATGGGGCCTGGTCGTGGGAGG - Intronic
1154297017 18:13160482-13160504 GCCTGTGGCCTGATGCAGGCAGG + Intergenic
1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG + Intergenic
1155486188 18:26345351-26345373 CCCTGTGGGCTGCTCCTTGCAGG + Intronic
1155540385 18:26863400-26863422 GCCCGTGGCAGGCTCCCGGGCGG + Intronic
1156327236 18:36085466-36085488 GCTTGAGTCCTGCTCCTGGGAGG - Intergenic
1156400198 18:36732799-36732821 GGCAGTGGCCTGCTGTTGGGTGG + Intronic
1156735476 18:40253366-40253388 AGCAGTGGCTTGCTCCTGGGAGG - Intergenic
1157200288 18:45653843-45653865 GCCTGTGCCCTGCCCCTATGGGG + Intronic
1157257725 18:46153378-46153400 GCCTGTGGCCTCCTCCTTATCGG - Intergenic
1157452197 18:47797180-47797202 CCCTGTGGCCTGCTTCTGGCTGG + Intergenic
1158458873 18:57630429-57630451 GCCTGGGGACAGCTCCTGGAAGG - Intergenic
1160501513 18:79403410-79403432 GCCCGGGGCCTGCTCCTGGGTGG - Intronic
1160739456 19:679294-679316 GCATGTGGGCCGCACCTGGGCGG - Intronic
1160865018 19:1252621-1252643 GCCTGTGTCACCCTCCTGGGAGG - Intronic
1160950766 19:1666138-1666160 GCATGTGCCCTGCACCTGGCCGG + Intergenic
1161007907 19:1945446-1945468 CCCTCAGGCGTGCTCCTGGGTGG + Intronic
1161173293 19:2824143-2824165 GCCTGGGTCCTGCGCCTGGGAGG + Intronic
1161340459 19:3739048-3739070 GCCAGTGGCCTCCTCGTGCGTGG - Exonic
1161531492 19:4792570-4792592 CCCTGCGACCTGCTCCTGGCCGG - Exonic
1162026231 19:7895510-7895532 GCCTGTGTCCGGCTCCTCGGAGG + Intronic
1162231540 19:9270848-9270870 GCCTGGGTCCTGTGCCTGGGAGG - Intergenic
1162412581 19:10515333-10515355 GCCTCAGGCCTGAGCCTGGGGGG - Intronic
1162873066 19:13600329-13600351 CTCTGTGGCCGGCACCTGGGAGG - Intronic
1163267194 19:16228361-16228383 GCCTGGGGCCTGCTCCTAGATGG + Intronic
1163609403 19:18293062-18293084 GCTTAAGGCCTGCCCCTGGGGGG - Intergenic
1163765802 19:19162653-19162675 TCCCTGGGCCTGCTCCTGGGAGG + Intronic
1164119608 19:22254414-22254436 GCCTGTGCCCTGCCCATGAGGGG - Intergenic
1164201250 19:23020660-23020682 ACCTGTGGCCTGCCCACGGGAGG - Intergenic
1164205610 19:23056194-23056216 GCCTGTGTCCTGCTTTTAGGAGG - Intergenic
1164557994 19:29268373-29268395 GACTGTGGGCAGCTCCAGGGAGG + Intergenic
1165060289 19:33201788-33201810 GCCAGCCGCCTGGTCCTGGGAGG + Intronic
1165084291 19:33332543-33332565 GTCTGTGACCTTCTCCTGAGAGG + Intergenic
1165409155 19:35648242-35648264 TTCAGTGGCCTCCTCCTGGGAGG + Exonic
1165435172 19:35791374-35791396 GGCTGGGGCCTGCTCGTGAGTGG - Intergenic
1166614205 19:44228469-44228491 GGCTGTGGTCTTCTCCAGGGAGG + Exonic
1166765986 19:45252174-45252196 GCCTGTGGGCAGCCCCTGGCAGG + Intronic
1166984200 19:46649753-46649775 CCCGGAGGCCTGCTCCTCGGCGG - Exonic
1167395735 19:49227266-49227288 GCCTGTGACCTGTTTCTGTGTGG + Intergenic
1167817534 19:51896933-51896955 GGCTGTGGACTTCACCTGGGAGG - Exonic
1167828971 19:52002236-52002258 GGCTGTGGACTTCACCTGGGAGG - Exonic
1168064775 19:53912883-53912905 GCGTGTGGCCTGCTCCTGGTAGG + Exonic
925152310 2:1623219-1623241 CCCTGTTGTGTGCTCCTGGGTGG + Intergenic
925413826 2:3655935-3655957 GCCTGTTGCCCGCTCCGGTGGGG + Intergenic
925655916 2:6149075-6149097 TCCTGTGGACAGCTGCTGGGAGG - Intergenic
925751237 2:7091731-7091753 ACCTGTGGCCAGCTCCAGGCAGG - Intergenic
926892288 2:17649077-17649099 GCCTCAGTCCTGTTCCTGGGGGG + Intronic
927110380 2:19860282-19860304 GCCTCTGCCCTGTTCCTGGCAGG + Intergenic
927435049 2:23059543-23059565 GCCTGTGACTTGCTCCTAGAAGG - Intergenic
927858483 2:26542681-26542703 TCCTGTGTCCAGCTCCTTGGAGG - Intronic
928162998 2:28946219-28946241 GCCTGAGGCTTGAACCTGGGAGG + Intronic
928179280 2:29056579-29056601 GCCTGTGGCCTGCTGGCGTGTGG + Exonic
928378510 2:30798638-30798660 GCCTGCGGCCCTCTCCTGGCTGG + Intronic
928396710 2:30948302-30948324 GCCCTTGCCCAGCTCCTGGGAGG + Intronic
928898915 2:36296994-36297016 GCCCGTGCCCTCATCCTGGGGGG + Intergenic
929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG + Intronic
930758458 2:55004380-55004402 ACCTGTGGCATGGTCCTGTGTGG + Intronic
931720172 2:65061755-65061777 GACTGAGGCCTGCTTCAGGGTGG - Intronic
931779105 2:65564560-65564582 GCCTGTGCCCTCCAGCTGGGGGG + Intergenic
934522255 2:95026719-95026741 GCCGCTGGCCTTCACCTGGGAGG + Intronic
935279429 2:101504794-101504816 CTCTGTGGCCTGCTACTGAGGGG - Intergenic
935292822 2:101624598-101624620 GCCTGGGGCCTGGGACTGGGAGG + Intergenic
935305849 2:101735600-101735622 GGCTGGGGCCTGCCCATGGGAGG + Intronic
935946194 2:108288824-108288846 CCCTGTGACCTGGCCCTGGGAGG - Exonic
936750374 2:115634721-115634743 GCATGTTGGCTGCTCCTTGGTGG + Intronic
937091235 2:119207724-119207746 GCCGGTGTCCTGCTCCAGGTAGG + Intergenic
937233411 2:120415942-120415964 GCCTCTGCCCACCTCCTGGGAGG + Intergenic
938105329 2:128526192-128526214 GCCTCCTGCCTGCTCCTGGATGG + Intergenic
938373296 2:130787464-130787486 AACAGTGGCCTGCACCTGGGAGG - Intergenic
938374304 2:130795779-130795801 GCCTGTAGGTTACTCCTGGGTGG - Intergenic
939188060 2:138883577-138883599 GCCTTTTCCCTGCTCCTAGGAGG + Intergenic
940396380 2:153196567-153196589 GCCTGAGTCCTGCACCTGGGAGG + Intergenic
941116747 2:161480494-161480516 TCCTGTGCGCTGCTCCTGGCAGG + Intronic
942045118 2:172095517-172095539 CCCTGCGGCCTGATGCTGGGCGG - Intergenic
942318109 2:174712973-174712995 GCCTGTGACAGGCTCCTGGCTGG - Intergenic
942744157 2:179212727-179212749 GTCTTTGGGCTGCTACTGGGAGG - Intronic
946427694 2:219608239-219608261 GCCTCTGGCTTCCTCCTGCGGGG - Exonic
947372513 2:229463113-229463135 GCCTGTGGTCTTATTCTGGGTGG - Intronic
947535865 2:230940134-230940156 GCCTCCCGCCTGCCCCTGGGAGG - Intronic
947710769 2:232314221-232314243 GCCTGTTGTCTGGTGCTGGGAGG + Intronic
947742331 2:232490395-232490417 TCCTGCGGCCTGCACGTGGGTGG + Intergenic
948197744 2:236107782-236107804 GCCTGGGGCCTGCACCTGCCGGG + Intronic
948436337 2:237956452-237956474 GACTGTGGCTTCCTCCTGCGCGG + Intergenic
948691952 2:239711704-239711726 ATCTGTGTCCTGCACCTGGGAGG + Intergenic
1169012883 20:2265153-2265175 GTCTGTCGGCTGCTACTGGGAGG - Intergenic
1170100419 20:12693397-12693419 TGCTATGGGCTGCTCCTGGGTGG + Intergenic
1170625316 20:18025832-18025854 GGCTGCCGGCTGCTCCTGGGTGG + Intronic
1171056251 20:21909650-21909672 GGCTGAGGGCTGCTCCTGGAGGG - Intergenic
1172117586 20:32581955-32581977 GCCATTGGCCTCTTCCTGGGAGG - Intronic
1172969443 20:38862734-38862756 GACTGTGGCCTGCCCTAGGGTGG + Intronic
1173307589 20:41864676-41864698 GCTGATGGCCTGCTCCAGGGAGG - Intergenic
1173458000 20:43219182-43219204 GACTGTGGCCTCATCTTGGGTGG + Intergenic
1173810636 20:45953092-45953114 GCCCTTGGCCAGCACCTGGGCGG - Intronic
1173825810 20:46047103-46047125 GCTGGTGGCCTTCTCCTGGGAGG + Intronic
1174408266 20:50317187-50317209 TCCTGTGGGCCCCTCCTGGGTGG + Intergenic
1175133584 20:56807149-56807171 GCCTGTGCCCTGCAAGTGGGCGG - Intergenic
1175281176 20:57805029-57805051 GGCGGTGGCCTGGCCCTGGGTGG - Intergenic
1175824594 20:61930154-61930176 GCCTGTGGGCAGCTCCCAGGTGG + Intronic
1175978742 20:62726571-62726593 GCCTGTGGCCCCTGCCTGGGAGG + Intronic
1176112979 20:63418920-63418942 GGCTGTGTCGTGCTCCTGTGGGG - Intronic
1176138278 20:63534533-63534555 GCCAGTGGCCTCCGCCTGGATGG + Intronic
1176294752 21:5065498-5065520 GCATGTGTCTTGCTCCTGGAGGG + Intergenic
1178061358 21:28856673-28856695 GGCTCTGTGCTGCTCCTGGGTGG - Intergenic
1178342825 21:31800686-31800708 GCCTCAGTCCTGCTCATGGGGGG + Intergenic
1178427894 21:32493473-32493495 GCCTGTGGCCAGCCCCTGCAGGG + Intronic
1179616221 21:42585003-42585025 GTCTTTGGCCTGCCCCTGGGAGG + Intergenic
1179719358 21:43306587-43306609 GCTTGTGGGGTGCTCTTGGGAGG - Intergenic
1179796755 21:43789486-43789508 GGCGGTGGCGTGCGCCTGGGCGG + Intergenic
1179862299 21:44196628-44196650 GCATGTGTCTTGCTCCTGGAGGG - Intergenic
1180005871 21:45020264-45020286 GCCTGTGCCCTGCTCCCCAGTGG + Intergenic
1180087939 21:45516389-45516411 GCAGGTGGCCTGCTTCTGCGTGG + Intronic
1180868897 22:19135000-19135022 GGCTCTGGCCTGCTCCTGTTCGG - Intronic
1180877418 22:19181089-19181111 GCATGTGGCCTGCTTATGGGGGG + Intronic
1181112760 22:20611590-20611612 GGCTGTGGCCAGGTCCTCGGGGG - Intergenic
1181477211 22:23176129-23176151 GCCTGATGCCTGCTCATGGATGG + Intergenic
1181876049 22:25941725-25941747 GCCTGGGGCCTGCCCCGTGGAGG + Intronic
1183019867 22:35018433-35018455 GCCTGTGGCCTGGCACAGGGAGG + Intergenic
1183033131 22:35120332-35120354 GCCTGTGGGGGGCTTCTGGGAGG - Intergenic
1183518897 22:38284806-38284828 GTCACTGGCCTGCTCCTAGGGGG - Intergenic
1183674284 22:39291030-39291052 GCCTGGGGCCTGCTCCTCTGAGG - Intergenic
1183686357 22:39363400-39363422 GACAGTGGCCTGCCCCAGGGTGG + Intronic
1183840754 22:40498737-40498759 GCCTGTGGCCTGCTCCTGAGAGG - Intronic
1184221261 22:43101445-43101467 GCCTTGAGCCTGCTCCTGGCAGG + Intergenic
1184317356 22:43706244-43706266 GCCAGGGGCCTGCTCCTGGGAGG + Intronic
1184339603 22:43879071-43879093 CCCTCTGGCCATCTCCTGGGTGG - Intergenic
1184831805 22:46993676-46993698 GCCTGCGGGCAGCTGCTGGGAGG + Intronic
1185000783 22:48244413-48244435 GCCGTGGGCTTGCTCCTGGGTGG + Intergenic
1185026245 22:48414846-48414868 GCCTGTGGCCTGCCCCACTGGGG - Intergenic
1185103815 22:48856037-48856059 GACTGAGGCCTGGTCCAGGGTGG - Intergenic
1185276370 22:49951709-49951731 GCCTGGGGCCTGGCCCTGAGTGG + Intergenic
1185318057 22:50187221-50187243 GACTGTGACCAGGTCCTGGGAGG + Intronic
949596465 3:5553088-5553110 GCCAGTGCCCTGCTACTGGCTGG - Intergenic
949942141 3:9163309-9163331 GCCTGGGGCCTCCTCCAGGGCGG + Intronic
950419698 3:12891589-12891611 GCCTGTGGCCTGGGACTGAGAGG - Intergenic
952338289 3:32423824-32423846 ATCTGTGACCTGCACCTGGGGGG - Intronic
952886887 3:38017630-38017652 GCCTGGATCCTGCTGCTGGGAGG - Intronic
952991909 3:38837594-38837616 GGATGTGGCCCTCTCCTGGGAGG + Intergenic
953031925 3:39185195-39185217 GCCTGTAGCCTGATTCTTGGTGG + Exonic
954693178 3:52406639-52406661 GCCTGTGGCCTGCTCCTGGGTGG - Intronic
954866390 3:53733180-53733202 GGGTGTGGCCAGGTCCTGGGAGG + Intronic
955111969 3:55958770-55958792 TCCTGGTGCCTGCTCCTGTGTGG - Intronic
956614054 3:71153222-71153244 GCCTGAGCTCTGCTCCTGAGAGG - Intronic
959591971 3:108091204-108091226 GCCGGATGCCTGCTCCAGGGCGG + Intergenic
960122516 3:113961330-113961352 CACTGTGGACTGTTCCTGGGGGG + Exonic
960456047 3:117873460-117873482 GCCTGTGGCCTGCAGCAGGGTGG - Intergenic
960536365 3:118818850-118818872 GCCTGTGGCCTGGTTCATGGTGG + Intergenic
961670271 3:128523651-128523673 TCCTGTGGAAGGCTCCTGGGAGG + Intergenic
964744680 3:160001342-160001364 GCCTCTGACTTGCTCCTGGTAGG - Intergenic
966223813 3:177576901-177576923 CCCAGTGGTCTGCTCCTTGGAGG - Intergenic
967507681 3:190271494-190271516 TTTTATGGCCTGCTCCTGGGAGG + Intergenic
968641530 4:1717348-1717370 GCCTGTGGCTGCCTCCTGGCAGG + Exonic
968748180 4:2371956-2371978 GCCTCTAGGCTGCTCCTGTGTGG - Intronic
968799445 4:2732662-2732684 ACCTGGGACCTGCTCCGGGGTGG - Intergenic
968868009 4:3226164-3226186 CCCTGGGGCCAGCTCTTGGGGGG + Intronic
968922729 4:3531018-3531040 ACCTGTTCCCTGCTGCTGGGAGG + Intronic
968956192 4:3721090-3721112 CCCTGTGCCCTGGTCTTGGGGGG + Intergenic
969161947 4:5267967-5267989 GCTTGGGGCATGCTCTTGGGAGG + Intronic
969622467 4:8285611-8285633 GCCTGGGACCTTCTCCAGGGTGG - Intronic
970450965 4:16166148-16166170 GCCTGGGAGCTGCTCCTGGAAGG + Intronic
971192555 4:24441377-24441399 GCCCGTGGGGTGCTGCTGGGAGG + Intergenic
972235789 4:37132598-37132620 GCCACTGGCCTGCTCCTGCTAGG + Intergenic
973784544 4:54322900-54322922 GGCTGAGGCCTGAGCCTGGGTGG - Intergenic
974793075 4:66714607-66714629 TCCTGTGGGCTCCTACTGGGAGG - Intergenic
974853945 4:67436942-67436964 GACTGTGGCCAGCTGCTGGTTGG - Intergenic
975022035 4:69502008-69502030 GCCTCTGCATTGCTCCTGGGTGG + Intronic
975141642 4:70924638-70924660 CACTGTGGCCTGCTGGTGGGTGG - Intronic
975409241 4:74029516-74029538 GCCTGTATTCTGCTCCAGGGTGG + Intergenic
977584568 4:98760606-98760628 GCCTGTGGACTGCTCTTGAAAGG - Intergenic
980463974 4:133150814-133150836 GCCGGTGCGCTGCTGCTGGGGGG - Exonic
981933914 4:150218695-150218717 GCCTGTGGCCTGACCATGTGGGG + Intronic
982300071 4:153869091-153869113 GCCTGTGCCCTTCTGCTGGGTGG + Intergenic
984255156 4:177381949-177381971 GCCTGGGTCCTGTGCCTGGGAGG + Intergenic
985426803 4:189839469-189839491 TCCTGTGTCCTTCTCCTCGGTGG - Intergenic
985426813 4:189839509-189839531 TCCTGTGTCCTTCTCCTCGGTGG - Intergenic
985487383 5:159060-159082 GCCTGTGCCCTGCTTCTCGGTGG + Intronic
985575588 5:672082-672104 ACCTGGGTCCTGCTCCTGGGAGG + Intronic
985688250 5:1293554-1293576 GTCTGTGTCCTCCTCCTCGGGGG + Exonic
988093324 5:26569604-26569626 GCCTGAATCCTGTTCCTGGGAGG + Intergenic
990387067 5:55275830-55275852 GCCTCTGCCCTGCTCCTGCCAGG + Intronic
990760791 5:59127340-59127362 GCCTCTGTCCAGCACCTGGGTGG + Intronic
992619014 5:78574288-78574310 GCCTTTGCCCTGCTGCTGGAGGG - Intronic
996080864 5:119256392-119256414 GGCTCTGGGCTGCTACTGGGGGG - Intergenic
996769736 5:127073510-127073532 GCCTGGGGCCGGCGCCTGGTGGG - Intergenic
997472462 5:134124492-134124514 GAGTCTGGCCTTCTCCTGGGAGG + Intronic
997509180 5:134441665-134441687 GCCTGTGGCTGCCTCCTGAGGGG - Intergenic
997601195 5:135139762-135139784 GCCTGTGGCATGCTCCTGGGGGG + Intronic
997783150 5:136680200-136680222 TCCAGTGGCCTGGTGCTGGGGGG - Intergenic
997892591 5:137688246-137688268 GCCTGTGATCCTCTCCTGGGTGG - Intronic
998616257 5:143743884-143743906 GCCTGTGTCCTGGTCCTGGATGG - Intergenic
999260062 5:150232782-150232804 GCCTGAGGTGTGCTCCTGTGTGG - Intronic
999799514 5:155019856-155019878 GCCTGGGTCCTGCGCCTGGGAGG + Intergenic
1001027532 5:168236675-168236697 GCCTGTGGCCTGCCCCTCTAGGG + Intronic
1002181563 5:177433543-177433565 ACCTGTGGCCCGCACCTGGCAGG - Exonic
1002527429 5:179822568-179822590 GCCTGTGACCTGCTCCTGAGGGG - Intronic
1002688964 5:181037295-181037317 GCCGGGGTCCTGCTCCTGGGAGG - Intergenic
1002966373 6:1970516-1970538 GCCTGCGGCCTGCTCCTGGTCGG - Intronic
1003502720 6:6715578-6715600 CCATGGGGCCTGGTCCTGGGGGG - Intergenic
1003961846 6:11216066-11216088 GCCTGTGAGCTGCTTCTTGGGGG + Intronic
1004306396 6:14505493-14505515 CCCTTTGCCCTGGTCCTGGGAGG + Intergenic
1006388635 6:33746205-33746227 GCCTGGGGCCTGGTGCAGGGTGG - Intronic
1006634441 6:35452207-35452229 GCCTGGGGCGTGCCCATGGGAGG - Intergenic
1006753670 6:36396345-36396367 GCCTGGGTCCTGCAACTGGGAGG - Intronic
1007072969 6:39049708-39049730 ACCTGTGGCCTGCTCTCTGGTGG - Intronic
1007376960 6:41463479-41463501 GCCTGAGGCCCCCTGCTGGGCGG - Intergenic
1007742587 6:44021857-44021879 GCCTGTGGGCAGCTCTAGGGAGG - Intergenic
1007743161 6:44025076-44025098 GCCTGTGGGCAGCTCTAGGGAGG - Intergenic
1007934302 6:45719465-45719487 GCCTCTGGTATGGTCCTGGGAGG + Intergenic
1010883959 6:81214920-81214942 GCCCGGGTCCTGCACCTGGGAGG - Intergenic
1013514590 6:110874576-110874598 GGCTCTGGCCGGCTCCTGAGTGG - Intronic
1013889138 6:115005115-115005137 CCCTGTGGCCTCCTGCTGGCAGG - Intergenic
1015551480 6:134416740-134416762 GCCTGTGGCCTGCGCCGCAGAGG + Intergenic
1016339752 6:143049798-143049820 GCCTAGGTCCTGCACCTGGGAGG + Intergenic
1016974579 6:149794721-149794743 GCCTTTGCCCTGATCCTGTGTGG + Intronic
1017709004 6:157148957-157148979 GCCCGGGGCGTGCTCCTGGGTGG - Intronic
1018239100 6:161754609-161754631 GCCTGTGACCTGACCATGGGAGG - Intronic
1018901584 6:168054378-168054400 GTCCTTGGCCTGCTCCTTGGGGG + Intergenic
1019147467 6:169984458-169984480 GCCTGTGGCCTGCAGGAGGGAGG - Intergenic
1019208579 6:170384741-170384763 GCCTTTGGCCTGCTTTTGTGTGG + Intronic
1019349998 7:550141-550163 CTCTGTGGGCTTCTCCTGGGGGG - Exonic
1019474398 7:1236886-1236908 GCAGGTGGCCGGCTCCTCGGCGG - Exonic
1019479452 7:1259917-1259939 GCCTGTGGCCTCCTCCCTCGTGG + Intergenic
1020092230 7:5348258-5348280 CCCTGTCACCTGCTCATGGGTGG - Intronic
1020139708 7:5605687-5605709 GGCTGCGGCCTGGCCCTGGGAGG + Exonic
1023823151 7:43991217-43991239 CCCTGTAGCCTGGCCCTGGGAGG + Intergenic
1023863773 7:44229358-44229380 GCCTGGGTCCTGCTGCTGTGGGG - Intronic
1023999333 7:45180519-45180541 GCCTGTGGCCTTCCCTGGGGAGG + Intronic
1024984824 7:55185980-55186002 GCCTGTGAGCTGCTAATGGGAGG + Intronic
1026632788 7:72052518-72052540 CCGTGTCTCCTGCTCCTGGGTGG + Intronic
1029101646 7:98135934-98135956 GCCTGAGGCCTGCTGTTGCGTGG - Intronic
1029129466 7:98319058-98319080 TCCTGTGGCCTCCTGCCGGGAGG + Intronic
1029404523 7:100366677-100366699 GCCTGTGGTTTCCTTCTGGGTGG - Intronic
1029604062 7:101588022-101588044 GCCTGTGACCTGCTCTGGGCTGG + Intergenic
1029617199 7:101666348-101666370 GCCTGTCCCATGCTCCTGGCTGG + Intergenic
1029751415 7:102544655-102544677 CCCTGTAGCCTGGCCCTGGGAGG + Intronic
1029769367 7:102643748-102643770 CCCTGTAGCCTGGCCCTGGGAGG + Intronic
1033552274 7:142458259-142458281 TCCTGTGCCCTGCACCTGGCAGG - Intergenic
1033554538 7:142477208-142477230 TCCTGTGCCCTGCACCTGGTGGG - Intergenic
1033556815 7:142495313-142495335 TCCTGTGCCCTGCACCTGGCAGG - Intergenic
1035254557 7:157618149-157618171 GACTGTGTCCATCTCCTGGGTGG + Exonic
1035655819 8:1303865-1303887 GCCTCTGGCCAGAGCCTGGGAGG + Intergenic
1036658214 8:10691226-10691248 GGCTGTGACCTGCTCCTAAGAGG - Intronic
1037835867 8:22214395-22214417 GCCTGCAGCCAGCTCCTGAGGGG - Intergenic
1039502838 8:38030739-38030761 GCCGCTTGCCGGCTCCTGGGCGG + Intronic
1039820413 8:41129598-41129620 GCCTCTGCACTGCTCCTGGGTGG - Intergenic
1040065127 8:43139334-43139356 GCCTGTGCACTGCTCTGGGGTGG + Intergenic
1040381138 8:46874530-46874552 GCCTGTGCCCTGCCCCTAGAAGG - Intergenic
1041201207 8:55453060-55453082 GGCTGGGGCCTGATCCTCGGTGG + Intronic
1045111556 8:98942090-98942112 GCGGGTGACCTGCTCTTGGGTGG + Intronic
1045246437 8:100445487-100445509 GCCTGGGGCCTGGGCCAGGGAGG + Intergenic
1046231024 8:111358552-111358574 GAGTGTGCCCTGCTCTTGGGGGG + Intergenic
1047000559 8:120568660-120568682 AGCTTTTGCCTGCTCCTGGGCGG - Intronic
1049170863 8:141159850-141159872 GCCTTTGGCCATCTCCTGGTGGG + Intronic
1049391337 8:142373162-142373184 GCCTGCTGCCTGGTCCTGTGAGG - Intronic
1049601177 8:143508350-143508372 GCCTGTGCCCTGCACAGGGGAGG + Intronic
1051709717 9:19919196-19919218 GGCTGTGGCTTGCTCCCGGGGGG + Intergenic
1052633643 9:31071962-31071984 GCTTGGGTCCTGCGCCTGGGAGG + Intergenic
1052916767 9:33929078-33929100 TCCTTTGGCCCGCTCCTGGTGGG - Intronic
1053270985 9:36749407-36749429 GCCTCTGGGCCGCTGCTGGGAGG - Intergenic
1053514985 9:38723039-38723061 GCCTGGTTCCTGGTCCTGGGTGG + Intergenic
1053825080 9:42014151-42014173 ACCTGTGGCCTGCTTCCTGGGGG + Intronic
1054605490 9:67173212-67173234 ACCTGTGGCCTGCTTCCTGGGGG - Intergenic
1055962499 9:81833832-81833854 GCCTGTGCCTTGCCACTGGGTGG + Intergenic
1056179913 9:84072727-84072749 GCCTTTGACCAGCTTCTGGGAGG + Intergenic
1056267902 9:84917865-84917887 GCCTCTGCCCACCTCCTGGGAGG + Intronic
1056501810 9:87217060-87217082 GCCAGTGGCTTGCTCCTGGCTGG + Intergenic
1056532237 9:87497958-87497980 GTCTGGGGCCGGCGCCTGGGAGG + Exonic
1056549076 9:87636295-87636317 GCCTGTGGACTGCTCACAGGAGG + Intronic
1056933810 9:90900300-90900322 GCCAGTGGCCATCTGCTGGGAGG + Intergenic
1057653599 9:96936354-96936376 GGCTGCTGCCTGGTCCTGGGGGG + Intronic
1059021389 9:110579951-110579973 GCCTTTGGCTTGATCCCGGGAGG - Intergenic
1059254304 9:112914733-112914755 GCTTGTGGGTTGCTCCTGGCTGG - Intergenic
1060140637 9:121206837-121206859 GAGGGTGGCCTGCGCCTGGGAGG - Intronic
1060828762 9:126701031-126701053 TCCTGTGGTCTTCTCCTTGGTGG + Exonic
1061708133 9:132468578-132468600 GGCTGTGGCCTGCTCTTGAGTGG - Intronic
1061919116 9:133772448-133772470 GCCTCGGGCCTGCTCCTCAGAGG + Intronic
1061936960 9:133863287-133863309 GCCTGCGCCCGGCTCCTCGGAGG - Intronic
1062206921 9:135342511-135342533 GCCTGTGCCAGGCTCCTTGGCGG - Intergenic
1062207573 9:135345844-135345866 GCCTGTGATCTGCTCCGGGTTGG - Exonic
1062215036 9:135384539-135384561 GGGCGTGGCCGGCTCCTGGGGGG - Intergenic
1062399875 9:136367610-136367632 GCCTGGGGCCTGCGGCAGGGAGG - Intronic
1062511247 9:136907355-136907377 GCCTCTGCCCAGCTCCTGGGTGG + Intronic
1062587247 9:137254952-137254974 GCCTGTGTCCGGCCCCTGCGGGG + Intergenic
1062622243 9:137428354-137428376 GCCTCTGCCCTCCTTCTGGGTGG - Intronic
1185593074 X:1291477-1291499 CCCAGTGCCCTGCTCCTGGCTGG + Intronic
1185774951 X:2794573-2794595 GGCCGTGGCCTGGGCCTGGGCGG - Exonic
1187397141 X:18928616-18928638 GCCTGTGGTGTGCACCCGGGTGG - Intronic
1189338114 X:40183168-40183190 GCCTGGGTCCTGGCCCTGGGAGG + Intergenic
1190681648 X:52831251-52831273 GCCTGGGTCTTGCACCTGGGAGG - Intergenic
1191694939 X:63979538-63979560 GCTTGCGGCTTGCTCCTGTGAGG + Intergenic
1192123419 X:68477707-68477729 GGCTGGTGCCGGCTCCTGGGGGG + Intergenic
1193211521 X:78811561-78811583 TCCTGGTGCCTGCTCCAGGGTGG - Intergenic
1193417392 X:81241080-81241102 TCCTGGTGCCTGCTCTTGGGTGG + Intronic
1193477292 X:81982189-81982211 GTCTGTTGGCTGCTACTGGGAGG - Intergenic
1196883757 X:120223822-120223844 GCCCGTGTCCTGCACCTGGGAGG + Intergenic
1197679898 X:129371236-129371258 GACTGTGGATTTCTCCTGGGAGG + Intergenic
1197916996 X:131546499-131546521 GCCTGGAGCCTGCTAATGGGGGG + Intergenic
1200092139 X:153641016-153641038 GCCAGAGGCCTGCTCCCAGGAGG + Intergenic
1200249211 X:154543312-154543334 GCCTGTGGCCAGCTTCGGGTTGG - Intronic