ID: 954696582

View in Genome Browser
Species Human (GRCh38)
Location 3:52430538-52430560
Sequence CAGCAAAGGTGGCCAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954696573_954696582 -7 Left 954696573 3:52430522-52430544 CCAGTAGTGGTACCCCCAGCAAA No data
Right 954696582 3:52430538-52430560 CAGCAAAGGTGGCCAGGGACTGG No data
954696572_954696582 -6 Left 954696572 3:52430521-52430543 CCCAGTAGTGGTACCCCCAGCAA No data
Right 954696582 3:52430538-52430560 CAGCAAAGGTGGCCAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954696582 Original CRISPR CAGCAAAGGTGGCCAGGGAC TGG Intergenic
No off target data available for this crispr