ID: 954696890

View in Genome Browser
Species Human (GRCh38)
Location 3:52432339-52432361
Sequence GAGTGATGCAAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 511}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954696876_954696890 24 Left 954696876 3:52432292-52432314 CCAGGAAGGGGTCTGGTCCAGAG 0: 1
1: 0
2: 1
3: 16
4: 253
Right 954696890 3:52432339-52432361 GAGTGATGCAAGAGGGAAGAAGG 0: 1
1: 0
2: 5
3: 46
4: 511
954696884_954696890 -6 Left 954696884 3:52432322-52432344 CCGGACCACCCTTGGGAGAGTGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 954696890 3:52432339-52432361 GAGTGATGCAAGAGGGAAGAAGG 0: 1
1: 0
2: 5
3: 46
4: 511
954696881_954696890 7 Left 954696881 3:52432309-52432331 CCAGAGGGGTCTTCCGGACCACC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 954696890 3:52432339-52432361 GAGTGATGCAAGAGGGAAGAAGG 0: 1
1: 0
2: 5
3: 46
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954696890 Original CRISPR GAGTGATGCAAGAGGGAAGA AGG Intergenic
900543407 1:3215503-3215525 GAGTGGTGCAGGAAGGAAGGTGG + Intronic
900993464 1:6108288-6108310 GAGAGATGATAGAGGGAAGATGG + Intronic
901868508 1:12123669-12123691 GAGTGATGAAGATGGGAAGAGGG - Intronic
902161241 1:14532088-14532110 AAGTGGTGCAAGAAGGAAGGTGG + Intergenic
902333544 1:15742558-15742580 GAGGGATGGAAGAGAGAACATGG - Exonic
902584321 1:17428811-17428833 AAGTGAGGTGAGAGGGAAGATGG + Intronic
903268695 1:22174341-22174363 GAGGGATGGAAGAAGGGAGAGGG - Intergenic
903276444 1:22224928-22224950 AAGTGAAGCAAAAGAGAAGAAGG - Intergenic
903684349 1:25120079-25120101 GAGGGAAGAAGGAGGGAAGAGGG - Intergenic
903850945 1:26305806-26305828 GTTTGATGTAAGAGGCAAGATGG - Intronic
904036282 1:27560930-27560952 GAGGGAGGGAAGAGGGAAGCAGG - Intronic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
904887011 1:33746461-33746483 GAGTGATGGAGGTGGGGAGAGGG - Intronic
905014872 1:34770913-34770935 GAGAGATGCAGGAGAGAAGTAGG - Intronic
905365022 1:37446213-37446235 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
905893588 1:41531619-41531641 GAGAGATGGAAGACGGGAGATGG + Intronic
905893637 1:41531841-41531863 GAGAGATGGAAGACGGGAGATGG + Intronic
906470821 1:46129105-46129127 GAGGGAGGCAAGAGGAAGGAGGG + Intronic
907227580 1:52962762-52962784 GAGTGATGAAAGAAAGCAGAAGG - Intronic
907246552 1:53112857-53112879 GAGAGATGCGAGAGAGAAGAGGG + Intronic
907909365 1:58813640-58813662 GAGTGTAGAAAGATGGAAGAAGG + Intergenic
908085237 1:60625274-60625296 GAGGCATGCAAATGGGAAGAGGG + Intergenic
908649291 1:66314289-66314311 GGGTGAGGCATGAGGGGAGAGGG - Intronic
909195068 1:72609494-72609516 AAGAGATGCAGAAGGGAAGAGGG + Intergenic
909498276 1:76304349-76304371 GATGGAGGAAAGAGGGAAGAGGG - Intronic
909597368 1:77421745-77421767 GAGTGAAGCGAGAAGTAAGAGGG - Intronic
910521296 1:88124844-88124866 GAGTGAAGGAAGAGGAAGGAAGG + Intergenic
911686064 1:100779174-100779196 CAGTGAAGCAAGAGGAAAGCAGG - Intergenic
911785725 1:101944541-101944563 GATTGATGAATGAAGGAAGATGG - Intronic
913498289 1:119448151-119448173 GAGTGATTGAAGAGAGATGAGGG + Intergenic
914919368 1:151837304-151837326 GGAAGAGGCAAGAGGGAAGAAGG + Intergenic
915178943 1:154041684-154041706 AAGAGAGGCAAGTGGGAAGATGG - Intronic
915491158 1:156250749-156250771 GAGTGATGGAAGAGAAAAAAAGG + Intronic
915630482 1:157150432-157150454 GAATAATGGAAGAGGGTAGAAGG + Intergenic
916619510 1:166481017-166481039 GAGTGAAGGAAGAGGAAAGGAGG + Intergenic
916736722 1:167614140-167614162 GAGGGAAGAAGGAGGGAAGAAGG - Intergenic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917140306 1:171828523-171828545 GAGAGAAGCAAGAGGGTGGAGGG + Intergenic
917238133 1:172916895-172916917 GGGTGATGGAAGATGGAAGATGG - Intergenic
918018270 1:180659435-180659457 GAGGGAAGAAGGAGGGAAGAAGG - Intronic
918129831 1:181617601-181617623 GAGTGATGGAGGTGGGAAGAAGG - Intronic
918735755 1:188061020-188061042 GAGGGAAGAGAGAGGGAAGACGG - Intergenic
918761869 1:188420602-188420624 GAGTGAGGAAGGAAGGAAGAAGG - Intergenic
918922947 1:190738551-190738573 AAGAGATTCAAGAAGGAAGAGGG - Intergenic
919140140 1:193560229-193560251 GAGGGATGGATAAGGGAAGAAGG - Intergenic
919929802 1:202214014-202214036 GAGTTAGGGAAGAGGGCAGATGG + Intronic
920539162 1:206764557-206764579 CAATGATGCAAGAGAGAATAAGG - Intergenic
920783232 1:209014769-209014791 GGGGAATACAAGAGGGAAGAGGG + Intergenic
920805358 1:209228716-209228738 GAATGAAACAAGAGGGAAAATGG + Intergenic
921066839 1:211629321-211629343 GAATGGTGAAAAAGGGAAGATGG + Intergenic
921185370 1:212665513-212665535 GAGGGAGGGAAGAGGGAAGCTGG - Intergenic
923107303 1:230864657-230864679 GAGAGATGGAAGAGGCAAGTAGG + Intronic
1062981116 10:1723873-1723895 CAGTGATGCTACAGGGATGAAGG + Intronic
1063297287 10:4819648-4819670 AAATGAAGAAAGAGGGAAGAAGG + Intronic
1064340138 10:14478094-14478116 GGGTGATGGAGTAGGGAAGAAGG - Intergenic
1065930190 10:30472432-30472454 GAGTAAGGAAAGAGGGAAGTGGG + Intergenic
1066706564 10:38185810-38185832 AAGAGATCCAAGAGGGTAGATGG + Intergenic
1066982736 10:42434192-42434214 AAGAGATCCAAGAGGGTAGATGG - Intergenic
1067371764 10:45690569-45690591 AAGAGATCCAAGAGGGTAGATGG + Intergenic
1067388017 10:45835580-45835602 AAGAGATCCAAGAGGGTAGATGG - Intronic
1067418104 10:46121700-46121722 AAGAGATCCAAGAGGGTAGATGG + Intergenic
1067446248 10:46349021-46349043 AAGAGATCCAAGAGGGTAGATGG + Intergenic
1067503463 10:46828263-46828285 AAGAGATCCAAGAGGGTAGATGG + Intergenic
1067591130 10:47511750-47511772 AAGAGATCCAAGAGGGTAGATGG - Intronic
1067638249 10:48019842-48019864 AAGAGATCCAAGAGGGTAGATGG - Intergenic
1067716630 10:48695429-48695451 GAGTGCTGGAAGAGGGAACCTGG + Intronic
1067875246 10:50000519-50000541 AAGAGATCCAAGAGGGTAGATGG + Intronic
1067911935 10:50355274-50355296 GGGAGAGGGAAGAGGGAAGAGGG - Intronic
1068194645 10:53699835-53699857 GAGTGAGGCAAGCTGGAAGATGG + Intergenic
1068744253 10:60512012-60512034 GAGTGTTGCCACAGTGAAGAAGG - Intronic
1068847080 10:61689110-61689132 GTGTGATGCAAGATGGAGAAAGG + Intronic
1068972024 10:62969027-62969049 GAGTGATCCAAAAGAGATGAAGG - Intergenic
1069785704 10:70986531-70986553 GAGTGATGGGGGAGGGGAGAAGG + Intergenic
1070117383 10:73541982-73542004 GAGGGATGGGAGAGGAAAGAAGG + Intronic
1070134853 10:73684268-73684290 AAGAGATCCAAGAGGGTAGATGG - Intronic
1070698538 10:78581595-78581617 GAGTGAGACTAGTGGGAAGAAGG - Intergenic
1071281348 10:84106859-84106881 GAGGGTGGCAAGAGGAAAGAGGG + Intergenic
1071296904 10:84227688-84227710 GCATCCTGCAAGAGGGAAGATGG - Intergenic
1071397270 10:85236753-85236775 GATTGATGCCAGAGGGCAGGAGG + Intergenic
1071813198 10:89205886-89205908 GACTGATAAAAAAGGGAAGAGGG - Exonic
1071880099 10:89888062-89888084 CTGTGATGCTAGAGGCAAGACGG - Intergenic
1072312528 10:94170476-94170498 GAGGGATGCAGGAGAGAAGGTGG - Intronic
1074300398 10:112227828-112227850 CAGACAGGCAAGAGGGAAGAGGG - Intergenic
1074753553 10:116608902-116608924 GAGTGATTCAGGAGGCACGAGGG - Intronic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1075527728 10:123200348-123200370 GAGTGACCCAAGAGAGAACAAGG + Intergenic
1076530787 10:131142994-131143016 GAGAGAGGCAAGATGGACGAGGG + Intronic
1077163246 11:1123089-1123111 GAGAGAGGGAAGAGGGAGGAAGG - Intergenic
1078016494 11:7619425-7619447 GAGTGATCCAAGAGGCAGGCAGG + Intronic
1078016628 11:7620493-7620515 GAGTGAAGGAAGATAGAAGAGGG - Intronic
1079162076 11:18004611-18004633 GAGAGATGCAAAGGGGATGAGGG + Intronic
1079801722 11:24877725-24877747 GAGTGATGTGAGAGGGAGGTGGG - Intronic
1080132665 11:28815096-28815118 GGGTGAGGAAAGAGGGGAGATGG - Intergenic
1080153949 11:29085945-29085967 GAGTGATACAACAGGGCAAATGG + Intergenic
1080555142 11:33409075-33409097 GAATGATGCTAGAGGGAGGGGGG + Intergenic
1081012690 11:37834994-37835016 GAGTGAGGAAGGAGGGAAGTGGG - Intergenic
1081307390 11:41530233-41530255 GAGTGTTTCAAGAAGGAAGTAGG + Intergenic
1081641276 11:44755982-44756004 GAGAGATGGAGGAGGGAAGAGGG + Intronic
1083019369 11:59490744-59490766 GGCTGATGGGAGAGGGAAGAGGG + Intergenic
1083035229 11:59630951-59630973 TTCTGATGCAAGAAGGAAGAAGG + Intergenic
1083996294 11:66274727-66274749 GAGAAAGGCAAGAGGGGAGAGGG - Intronic
1084052986 11:66613106-66613128 GAGGGCTGCAGGAGCGAAGAGGG + Intergenic
1085775143 11:79358715-79358737 GAGGGAAGGAAGAGGGAAGGAGG - Intronic
1086540279 11:87900738-87900760 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
1087930011 11:103966190-103966212 GGGTGGAGGAAGAGGGAAGAAGG + Intronic
1088087704 11:106001427-106001449 GAGTAATGAAAAAAGGAAGATGG + Intronic
1088247536 11:107833639-107833661 GAGTCATGTAGGAGGGAACATGG - Intronic
1089390914 11:118101057-118101079 GAGTGAAGCAAGGGAGAAGGAGG - Intronic
1090167948 11:124571181-124571203 GAGGGAAGGAAGAGGAAAGAAGG - Intergenic
1091228757 11:133974308-133974330 GAGTGAGGCAAGTGGGAGTAGGG + Intergenic
1091437195 12:481852-481874 TCTTGATGCAAGAGGGAGGAAGG - Intronic
1092509961 12:9144381-9144403 AAGTGAAGTAAGAGGCAAGATGG + Intergenic
1092876894 12:12856295-12856317 GAGGGATGGGAGAAGGAAGAAGG - Intergenic
1093019981 12:14194316-14194338 GAGTGAAGGAAGAAGGAAGGAGG - Intergenic
1093091296 12:14924006-14924028 TGGTGATGGAAGAGGGAAGAGGG - Intronic
1094093621 12:26678228-26678250 CAGGGATGGAGGAGGGAAGATGG - Intronic
1095308959 12:40672811-40672833 GATTGATGCCAGAGGCATGATGG + Intergenic
1095336020 12:41027462-41027484 GAGAGATTCAAGAAAGAAGATGG + Intronic
1095382126 12:41607587-41607609 GAGTGATGGAAGATGGAGGTAGG + Intergenic
1096704631 12:53411373-53411395 GAGGGATACAAGAGAGGAGATGG + Exonic
1096933374 12:55241662-55241684 GAGTGATACAAAAGGGGAGCAGG + Intergenic
1097901562 12:64878690-64878712 GGGTGAAGGAAGAAGGAAGAAGG - Intronic
1098090812 12:66899116-66899138 GAGTGATCCAAGAAGCAATATGG - Intergenic
1098205336 12:68103293-68103315 GAGAGAAGCAAGAAGGAATAAGG - Intergenic
1098856725 12:75661165-75661187 AAGTGATAGAAGAGGGGAGAAGG - Intergenic
1099918156 12:88922126-88922148 CAGGGATGGAAGAGGGAAGCAGG + Intergenic
1100778899 12:98002851-98002873 GAGGGAGGGAAGAGGGAAGGAGG + Intergenic
1101015594 12:100497044-100497066 GGGCGATGCAACAGGGAAGGAGG + Intronic
1102513293 12:113429955-113429977 GAGGGAGGGAAGAGGGAAGGAGG - Intronic
1102824661 12:115937830-115937852 CACTGATGCAAGGAGGAAGAGGG - Intergenic
1102866894 12:116381862-116381884 GAGGGTTGAAACAGGGAAGATGG - Intergenic
1103030239 12:117606724-117606746 GAGTAAGGAAAGAAGGAAGAAGG - Intronic
1103043980 12:117719979-117720001 GAGTGATGAAGGAGTGGAGAAGG - Intronic
1103366967 12:120390568-120390590 AAGGGAGGGAAGAGGGAAGAAGG + Intergenic
1104415342 12:128593136-128593158 GAGAGAGGAGAGAGGGAAGAAGG - Intronic
1104415361 12:128593312-128593334 GAGAGAGGAGAGAGGGAAGAGGG - Intronic
1107568351 13:41629893-41629915 GAGGGATTAAAGAGGGCAGAGGG - Intronic
1108582145 13:51836892-51836914 GAGTGATTCAAGAGGTAAACGGG + Intergenic
1109551506 13:63907829-63907851 GGATGATGCAAGGGGGATGAGGG + Intergenic
1109935443 13:69277287-69277309 GAGTGATGGAAGTGAGAAGTAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112446763 13:99471581-99471603 GAGGGAAGGAAGAGGGAGGAAGG + Intergenic
1112922939 13:104637637-104637659 TAGGGCTGGAAGAGGGAAGAGGG + Intergenic
1113119076 13:106906977-106906999 AATAGATGCAAGAGGGAAAAAGG - Intergenic
1114270329 14:21097226-21097248 GAGTGAGGACAGAGGGAAGGAGG - Intronic
1114389821 14:22295074-22295096 GAATGAACCAAGATGGAAGAAGG - Intergenic
1115333038 14:32218888-32218910 GAGTGAAGAAAGAGGGAAAGAGG - Intergenic
1116745257 14:48809993-48810015 GACTACTGCAATAGGGAAGAGGG - Intergenic
1118358296 14:65034196-65034218 GACTGAAGCAGGAGGGCAGAGGG - Intronic
1118492367 14:66273578-66273600 GAGGGATGGAAGAGGGAGGGAGG + Intergenic
1118554933 14:67007851-67007873 GAGTGATGGAAGAGAGAGAAGGG + Intronic
1119121821 14:72086506-72086528 GAGAGATGCAAGAGCAAAGAAGG - Intronic
1119200311 14:72747167-72747189 GAGGGAAGGAAGAGGTAAGAGGG - Intronic
1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG + Intergenic
1119828720 14:77681382-77681404 GAGTGATGCAGTAGGCAATATGG + Intronic
1120602108 14:86523633-86523655 AAGTGAGGAAAGAGGGAGGAGGG - Intergenic
1120721237 14:87891622-87891644 GAGAGACAAAAGAGGGAAGAAGG + Intronic
1120764182 14:88313466-88313488 AAGTGATTCAAGAGAGAACAAGG - Intronic
1121624595 14:95374916-95374938 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624618 14:95374985-95375007 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624626 14:95375019-95375041 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624649 14:95375088-95375110 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624656 14:95375122-95375144 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624678 14:95375202-95375224 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624688 14:95375237-95375259 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624704 14:95375292-95375314 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624716 14:95375327-95375349 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121828396 14:97029177-97029199 AAGAGAAGAAAGAGGGAAGAAGG - Intergenic
1121952168 14:98181022-98181044 GAGAGAGGAAAGAAGGAAGAAGG - Intergenic
1122238033 14:100344063-100344085 GGGAGAGGGAAGAGGGAAGAGGG - Intronic
1122689927 14:103527455-103527477 CAGAGAGGCAAGAGGGAAGTCGG + Intergenic
1122861985 14:104586826-104586848 GGGTGTTGGAGGAGGGAAGAGGG + Intronic
1124456724 15:29849959-29849981 GAGTGATCCAAGAGAGAACAAGG - Intronic
1125286271 15:38095889-38095911 GATTGGAGCTAGAGGGAAGAGGG - Intergenic
1125296386 15:38207983-38208005 GAGAGAGGCAAAGGGGAAGACGG + Intergenic
1127608234 15:60611750-60611772 CAGTGATGAAAGAGTGAGGATGG - Intronic
1127762187 15:62150164-62150186 GAGCGCTCCATGAGGGAAGATGG - Intergenic
1127907584 15:63387674-63387696 GAGGGAGGAAGGAGGGAAGAAGG + Intergenic
1128570826 15:68731558-68731580 TAGGGAGGCAACAGGGAAGAGGG + Intergenic
1129494088 15:75960204-75960226 GAGTGATTAATGAGGGAAGTAGG + Intronic
1131875576 15:96802612-96802634 GACTGAGGAATGAGGGAAGAAGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1133422117 16:5654775-5654797 GAGAGAGGAAAGAAGGAAGAAGG - Intergenic
1134328477 16:13228840-13228862 GAATGATGAGAGAGGGAAGAGGG - Intronic
1134640738 16:15827555-15827577 GGGTGATGGAATGGGGAAGAGGG - Intronic
1135060416 16:19266831-19266853 GAGGGAGGCAAGAGGAAGGAGGG - Intronic
1135186046 16:20316849-20316871 GAGTGATGGAGGAGGAAAGGAGG - Intronic
1135504804 16:23027260-23027282 GTGGGATTGAAGAGGGAAGAAGG + Intergenic
1135928867 16:26719547-26719569 GAGTGAAGCAGGAGGGCAGAGGG - Intergenic
1136922484 16:34344318-34344340 TAGTGATTCAACAGGGAAGGGGG - Intergenic
1136982089 16:35067488-35067510 TAGTGATTCAACAGGGAAGGGGG + Intergenic
1138069010 16:53971967-53971989 GAGTGGTGAAGGAGGGAAGGGGG - Intronic
1138206267 16:55127397-55127419 AAGTGATCCAGGAGGAAAGACGG + Intergenic
1138344046 16:56309090-56309112 GAGTGAAGCAGGTGGGAAGGGGG - Intronic
1138680051 16:58677794-58677816 AAGAGATGCCAGAGGTAAGAGGG + Intronic
1139216221 16:65126118-65126140 GAGTGATGCAAGATCCAAGCGGG + Intergenic
1139409822 16:66750743-66750765 GAGTGAGGCCAGAGGGAGTAAGG + Intronic
1139522292 16:67490899-67490921 GGGTGATGCAGGTGAGAAGACGG - Intergenic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1140115539 16:72038252-72038274 GAGTGATCTAAGAGGGAGCAAGG + Intergenic
1140232822 16:73131983-73132005 CTGTGATGCAAGAGGGATGAGGG + Intronic
1140257523 16:73349789-73349811 GAGGGAGGGAAGAGGGAACAAGG - Intergenic
1140863490 16:79039705-79039727 GGGTGATGCTAGATGGAAGCAGG + Intronic
1141643422 16:85354809-85354831 GGGTGATGCTAGAGAGAGGAAGG - Intergenic
1142488955 17:265558-265580 AAGGGAGGGAAGAGGGAAGAGGG - Intronic
1142547814 17:717189-717211 GGGTGAGGCAAGAGGGAATTTGG - Intronic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144843039 17:18200265-18200287 GAGGAATGAAAGAGGGAAGGAGG + Intronic
1145203502 17:20967915-20967937 AAGTGAGGCAAGAGGGAACCAGG - Intergenic
1145285502 17:21503321-21503343 GAGGGATGCTGGAGTGAAGAAGG + Intergenic
1146085916 17:29829503-29829525 GAGAGAGGAGAGAGGGAAGAAGG + Intronic
1146461628 17:33050498-33050520 GAGTTAGGGAAGAGGGAAGTGGG - Intronic
1146689729 17:34865135-34865157 GAGTGATCGCAGAGGGAGGATGG - Intergenic
1146885053 17:36464891-36464913 GCGTGATGCAAACGGGAAGGCGG + Intergenic
1148397060 17:47317444-47317466 GAGTAATCCAAGAGAGAACAGGG + Intronic
1148735187 17:49861172-49861194 GAGAAAGGCAAGAGGGAGGAAGG - Intergenic
1148761403 17:50003594-50003616 CGGTGAGGCAAGAGGGTAGATGG + Intergenic
1148891171 17:50808365-50808387 GAGTGATGCAAAATGCCAGAAGG - Intergenic
1150471181 17:65438775-65438797 GAGGCATGCAAGAGGGAAGAGGG - Intergenic
1151237129 17:72728803-72728825 GAGTGAACTGAGAGGGAAGAAGG - Intronic
1151349708 17:73524566-73524588 CAGTCATGCTAGAGGGAAGAGGG - Intronic
1151960827 17:77404807-77404829 GAGAGATGGGAGAGGGAACACGG - Intronic
1152336122 17:79701066-79701088 GAGGGATGCAGGTGGGAGGATGG + Intergenic
1153586348 18:6624565-6624587 GAGAGATGAAGGAGAGAAGATGG - Intergenic
1153993347 18:10419172-10419194 AAGTGAGGCAAGAAGGAAAAGGG - Intergenic
1156173130 18:34510473-34510495 GACTGATGGAACAGGGAGGAGGG - Intronic
1156417382 18:36911070-36911092 GGAGGATGCAAAAGGGAAGAGGG - Intronic
1156729140 18:40169078-40169100 GAATGATGTAACAGGGCAGAGGG - Intergenic
1156736772 18:40269625-40269647 GAGAAATGAAAGAAGGAAGAAGG - Intergenic
1157171858 18:45414458-45414480 GACTGATGAGAGAGGGAAGAAGG - Intronic
1157758719 18:50242776-50242798 GAGGGATGCAAAAAGGATGAAGG - Intronic
1157759442 18:50249707-50249729 GGGTGGGGCAAGAGGGAAGTAGG + Intronic
1158121889 18:54057652-54057674 GTGTCATGAAAGAGGGAACAAGG - Intergenic
1158300543 18:56047239-56047261 GAGGGATGGAGGAGGGAGGAAGG - Intergenic
1158767188 18:60466419-60466441 AAATGATGGAAGATGGAAGATGG - Intergenic
1159088077 18:63817240-63817262 CATTGCTGAAAGAGGGAAGAGGG - Intergenic
1161427274 19:4210452-4210474 GAGAGATGGAGGAGGGAAGGTGG - Intronic
1162288655 19:9761360-9761382 GAGTGAAGCAAATGGAAAGATGG + Intronic
1162362158 19:10226947-10226969 GAGGGATGGAAGAGGGTGGAGGG - Intronic
1163093283 19:15036123-15036145 GAAGGAAGGAAGAGGGAAGAAGG + Intergenic
1164829443 19:31309258-31309280 GCGTGATGTAAGAGGGTAGGTGG + Intronic
1164945163 19:32287292-32287314 GACGGAAGCAAAAGGGAAGAAGG + Intergenic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1166252938 19:41584060-41584082 GAGTGATGTGAGAGGAAGGAGGG + Intronic
1166690955 19:44821010-44821032 GGGAGAGGGAAGAGGGAAGAGGG - Exonic
1166934143 19:46320956-46320978 GAGTGAAGGAAGAGGGAGAAAGG - Intronic
1167707010 19:51087036-51087058 GAGTGATTGAAGAGCTAAGAGGG + Intergenic
1168357688 19:55712777-55712799 GAATGAGGGAGGAGGGAAGAAGG + Intronic
1168433798 19:56302294-56302316 GAGGGAGAAAAGAGGGAAGAAGG - Intronic
1168460689 19:56554491-56554513 GAGTGATGCATGATGGCTGAAGG - Exonic
926244580 2:11113515-11113537 GAGGGAAGGAAGAAGGAAGAAGG - Intergenic
926660324 2:15458509-15458531 GAGGGAAGCAAGAGAGAAAAGGG - Intronic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
927322864 2:21768775-21768797 GAGAGATGAAAAATGGAAGACGG + Intergenic
927900117 2:26812933-26812955 GAGTGAGGCGAGAGCGATGAAGG - Intergenic
927947597 2:27146412-27146434 GAGCGATCCAAGAGGGAGCAAGG + Intergenic
928848932 2:35718143-35718165 GAGTGAAGTAAGAGCGAAGTGGG - Intergenic
928868713 2:35949693-35949715 GATTGATGCAAGAGGAACCACGG + Intergenic
928931741 2:36632019-36632041 GAGTGTGGCAAGAGGAAGGAGGG + Intronic
929252942 2:39779323-39779345 GTGTGATGCCAAAGGGGAGAGGG + Intergenic
929448968 2:42023987-42024009 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
929589326 2:43134753-43134775 GAGAGAAGCTTGAGGGAAGAAGG - Intergenic
929801549 2:45108758-45108780 GAGTGTTTCAAGAAGGAAGGAGG + Intergenic
929837468 2:45418711-45418733 GAGTTGTGCAAGAGGAAAGAAGG + Intronic
930286663 2:49437404-49437426 GATTAATGCAAGAGGAAAAAAGG - Intergenic
930752190 2:54945021-54945043 GAGTGAAGGAGGAGGGAAGGAGG - Intronic
931651050 2:64469137-64469159 GACTGATACAAGAGTGAACAAGG + Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932174351 2:69585969-69585991 GGGTGGTGCCAGAGGGAAGGTGG - Intronic
932465869 2:71923705-71923727 GACTGAAACAAGAGGGTAGATGG + Intergenic
932549399 2:72752572-72752594 GAGGGAGGGAAGAGGGAAGGAGG - Intronic
933591399 2:84236991-84237013 GTGTGATTCAAGAGTGAAGTAGG - Intergenic
933895425 2:86806708-86806730 GAGTGGTGCAAGCCGGAGGATGG - Intronic
934507851 2:94909104-94909126 TAGTGATGGAAGTGAGAAGAGGG - Intergenic
934991541 2:98925110-98925132 GGGAGAGGCAAGAGGGAAGGAGG + Intronic
935611374 2:105029314-105029336 GAGGGAGGAAAGAGGGAAGGGGG + Intergenic
935654842 2:105413247-105413269 GAGTGAAGAAATAGGGAAGAGGG - Intronic
936787260 2:116108403-116108425 GATTGAAGCAAGATGGAAGCAGG + Intergenic
938163847 2:129009423-129009445 GAGTGGAGCAGGTGGGAAGAAGG + Intergenic
938758718 2:134404146-134404168 AAGGGATGCAAGTGTGAAGAAGG + Intronic
939513396 2:143135673-143135695 GAGAGTTTCAAGAGGGAAGGAGG - Intronic
939571788 2:143848498-143848520 GAGTGAGAAAAGAGGGAAGGAGG - Intergenic
939648659 2:144734751-144734773 ATGTGAAGCAAGAGGGAACATGG + Intergenic
941953316 2:171178469-171178491 GAGTCAATGAAGAGGGAAGATGG - Intronic
942599904 2:177630164-177630186 GAGGGATGAAAGGGGGATGAGGG + Intronic
943040537 2:182799460-182799482 GAGTGAAACAAGAGAGAAGAAGG + Intergenic
944207421 2:197171244-197171266 GAGTGATGGGAGAAGGAAGCTGG + Intronic
944405329 2:199377586-199377608 GAGTGCAGGAAGAGGGAAGAAGG + Intronic
945777689 2:214127705-214127727 GACTGATGCAGTAGGGAAAAGGG - Intronic
946373441 2:219294521-219294543 GAGGGATGAAGGAGGGGAGACGG + Intronic
946836047 2:223773796-223773818 GAGTAAGGGAATAGGGAAGAGGG + Intronic
947041484 2:225926281-225926303 GAGTGATGAGAGATGGAACAAGG + Intergenic
947095091 2:226557593-226557615 GAAGGATGCAAGAGGCAGGAAGG - Intergenic
947117762 2:226790667-226790689 CAGTGATGCAAGAGGGATGTTGG + Intronic
947625639 2:231616504-231616526 GACTGATGGAGGAGGGAAGCAGG - Intergenic
947741762 2:232487927-232487949 GAGAGATGCAGGAGGAAGGAGGG - Intergenic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948668269 2:239549886-239549908 GAGCGATGCCACGGGGAAGACGG + Intergenic
1169055355 20:2616475-2616497 GAGGGAAGAAAAAGGGAAGAAGG + Intronic
1169772978 20:9221518-9221540 GAGTGAGGCAAGGAGGAAGATGG - Intronic
1170759451 20:19236853-19236875 GAGGGATGCAAGTGTGGAGATGG + Intronic
1170835283 20:19878637-19878659 GACTGAGGCAAGAGGACAGATGG - Intergenic
1171025157 20:21623705-21623727 GAGGGAGGGAAAAGGGAAGAAGG - Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1171335218 20:24379431-24379453 GAGTTTGGCAAGAGGCAAGAAGG - Intergenic
1171370924 20:24661493-24661515 GAGGGAGGGAAGAGGGAGGAAGG + Intronic
1172190395 20:33058854-33058876 GAGGGATGCAGAATGGAAGAAGG + Intronic
1172875097 20:38159204-38159226 GAGTGAAAGAAGAGGAAAGAAGG + Intronic
1173657374 20:44709658-44709680 GACTGAGGGAGGAGGGAAGAAGG + Intergenic
1173934254 20:46847376-46847398 GAGTGATGGGAGAGAGAGGATGG - Intergenic
1174758381 20:53182214-53182236 GAGGGAGTCAAGAGGGAAGGAGG - Intronic
1174927337 20:54774715-54774737 GAGAGATGCAAGGGAGAAGCAGG - Intergenic
1175160481 20:57004319-57004341 GAGGGATGCAAGGGCGATGAGGG - Intergenic
1175315200 20:58042411-58042433 GAGTGAAGCAGGAGAGAGGAGGG - Intergenic
1175934950 20:62510135-62510157 AAGGGATGCAGGATGGAAGAGGG - Intergenic
1175943074 20:62546807-62546829 GAGTGCAGCAAGAGGGGAGCCGG - Intergenic
1176181100 20:63749908-63749930 GAAGGAAGCAAGAAGGAAGACGG + Intronic
1176242581 20:64081898-64081920 CAGACAGGCAAGAGGGAAGAGGG - Intronic
1176264792 20:64203547-64203569 GAGGGAGGGAGGAGGGAAGAGGG - Intronic
1176723596 21:10412735-10412757 GAGTGATGGAGGGGGGAAAAGGG - Intergenic
1177548870 21:22595409-22595431 GAGTGAGAAAAGAGGGAATAAGG + Intergenic
1179179132 21:39030565-39030587 GAGTGATGGGAGAGGCCAGAGGG - Intergenic
1179619841 21:42606637-42606659 GAAGGTTGCAAGAGGAAAGAGGG + Intergenic
1179907670 21:44432608-44432630 GAGCAATGCAAGAGGGCAGGAGG - Intronic
1179911838 21:44455051-44455073 TCCTGATGCCAGAGGGAAGAGGG + Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180172054 21:46064756-46064778 GAGGGAGGGAGGAGGGAAGAAGG + Intergenic
1180616494 22:17131709-17131731 GGGTGTTGGAAGTGGGAAGATGG - Exonic
1181378342 22:22478705-22478727 GAGTGATCCAAAAGAGAACAAGG - Intergenic
1181901519 22:26160134-26160156 GAGAGAGGAAAGAGGGAGGAAGG + Intergenic
1181950602 22:26550931-26550953 GAGTGGTTCAAGAGGGAAAAAGG + Intronic
1181973957 22:26714872-26714894 GATCGATGCATGAGGGGAGATGG + Intergenic
1182800348 22:33026975-33026997 AAGGGAGGCAGGAGGGAAGAAGG - Intronic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183329633 22:37212376-37212398 GAGAGAGGCAGGAGGGAGGAAGG + Intergenic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1185004868 22:48269990-48270012 GAGAGATGGGAGAGGGGAGAGGG + Intergenic
1185194381 22:49459703-49459725 AAGGGATTCGAGAGGGAAGAAGG + Intronic
949109157 3:237543-237565 GAGTGATGCAATAAGAAAGAGGG + Intronic
949421525 3:3871516-3871538 CAGAGATGCCAGAGGGAACATGG - Intronic
949424250 3:3899372-3899394 GAGTGATCCAAGAGAGAAGGAGG - Intronic
950626133 3:14248513-14248535 GAGTGGTTCAAAAGGGTAGAGGG - Intergenic
950755092 3:15164178-15164200 GGGAGAGGGAAGAGGGAAGAGGG + Intergenic
951732311 3:25823824-25823846 GAGGAATGCAACAGGGAAGGAGG + Intergenic
952364529 3:32663441-32663463 GGGAGAGGGAAGAGGGAAGAGGG - Intergenic
953042500 3:39267673-39267695 GACTGATTCAAGATGGAGGATGG + Intronic
953160071 3:40410869-40410891 GGGTGATGGATGAAGGAAGAAGG + Intronic
953221025 3:40971614-40971636 GAGGGAGGGAAGAGGGAAGTCGG + Intergenic
953336397 3:42098037-42098059 GAGAGATGGAGGAGAGAAGAGGG - Intronic
953496900 3:43395053-43395075 GACTGAGGTGAGAGGGAAGAGGG + Intronic
953609094 3:44432774-44432796 CAGGGATGTAAGAGGGAAGCTGG - Intergenic
954619108 3:51985718-51985740 GAGTGGTGGGAGAGGAAAGACGG - Intronic
954696890 3:52432339-52432361 GAGTGATGCAAGAGGGAAGAAGG + Intergenic
955104593 3:55885068-55885090 GTGTGATGTTAGAGGGAAGAGGG - Intronic
956276705 3:67509953-67509975 GAGAGATGGAGGTGGGAAGAAGG + Intronic
956339927 3:68211088-68211110 GAGTGATCCAAGAGAGAACAAGG + Intronic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
958855767 3:99383209-99383231 AGGTGATGCAAGAGGAAGGAGGG + Intergenic
959700650 3:109295830-109295852 GAGTAATGCAAGTGGGAAGATGG + Intronic
960452197 3:117824342-117824364 TAATGATGAAAGAGGGAAGGAGG + Intergenic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
962203390 3:133417138-133417160 GAGAGATGAGAGAGGGGAGAGGG - Intronic
963866544 3:150368127-150368149 AAGTGATCCAAGAGAGAACAAGG + Intergenic
963922649 3:150920778-150920800 GGGTAAGGCAAGAGGGGAGAAGG + Intronic
964468595 3:157026539-157026561 AATTAATCCAAGAGGGAAGAAGG - Intronic
964739313 3:159948987-159949009 GAGTGATCCAAGAGAGAGCAGGG - Intergenic
965571940 3:170181712-170181734 TAGTGATGGAGGAGAGAAGATGG - Exonic
966277844 3:178197260-178197282 GGGAGATGCAGGAGGGAGGAGGG - Intergenic
966388468 3:179426990-179427012 GAGTGATACATGAGGTCAGAGGG - Intronic
966457286 3:180131919-180131941 TGGTGATGGCAGAGGGAAGAAGG + Intergenic
966471692 3:180296702-180296724 GTCTGATGCAAGTGGGCAGATGG + Intergenic
966559340 3:181302174-181302196 GACTGAGGCAAGAGGGAACATGG + Intergenic
966796381 3:183718505-183718527 GATTGAAGCAAGAAGGATGATGG + Exonic
967663551 3:192143973-192143995 AAGGGATGAGAGAGGGAAGAAGG + Exonic
967938826 3:194750392-194750414 GAGTGATGCATCTGGGCAGAGGG + Intergenic
968134365 3:196210647-196210669 GAGTGAAACAAGACTGAAGAAGG + Exonic
968744447 4:2352424-2352446 GAGGCGTGGAAGAGGGAAGAAGG + Intronic
969373238 4:6747280-6747302 GAGAGAGGCGAGAGGGAAGAAGG - Intergenic
969476312 4:7424403-7424425 CAGTGATGCCAGAGGGACAACGG - Intronic
969493345 4:7512374-7512396 GAGGGAAGAAGGAGGGAAGAAGG + Intronic
969723645 4:8906869-8906891 GAGGGAGGCAAGAAGGAAGGGGG - Intergenic
970204762 4:13644764-13644786 GGGTGAAGCAGGAAGGAAGAGGG + Intergenic
970740932 4:19236855-19236877 GAGTCAGGGAAGAGGAAAGAAGG + Intergenic
971272468 4:25163480-25163502 GAGTAATAAAAGAGGGAAGCTGG - Intronic
971412088 4:26384892-26384914 GGGAGAGGCAAGAGGCAAGAGGG - Intronic
974206677 4:58712442-58712464 AAGTAATTCAAGATGGAAGATGG - Intergenic
974514380 4:62890145-62890167 GTGTGGGGCAAGAGGAAAGAGGG - Intergenic
974557886 4:63475440-63475462 CAGTGATGCAGGAGGGAGAAAGG - Intergenic
976498523 4:85758643-85758665 GAGGAAGGCAAGTGGGAAGATGG + Intronic
976753375 4:88473312-88473334 GGGTGAGGCTAGAGGGAGGAAGG - Intronic
979538664 4:121854103-121854125 GAGTGATGGTAGAAGGAGGAGGG - Intronic
979807007 4:124986521-124986543 AAGTAATTCAGGAGGGAAGAGGG - Intergenic
980887217 4:138776169-138776191 GAGTAAGGCAAGAGGGATGAGGG - Intergenic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
981716427 4:147757040-147757062 GAATGATGCCAGAGGGAACCTGG + Intronic
982150434 4:152449356-152449378 GACTGATGGAAGAGGGTAGGAGG + Intronic
982781060 4:159492012-159492034 GTGGGATGCAAGAGTGAAGAAGG + Intergenic
982967359 4:161929299-161929321 GAGTGATGGAACAGAGTAGAGGG - Intronic
983450801 4:167908695-167908717 GAGTTAGGCATGAGGGGAGATGG + Intergenic
983515425 4:168651073-168651095 GATTGATGCAAGAAGGCAAAAGG + Intronic
984830410 4:183967457-183967479 GAGTGGTGCAAGAGGAAGAAAGG + Intronic
985754981 5:1708495-1708517 GATTGATGAAACAGGGACGAGGG + Intergenic
986778785 5:11045356-11045378 GAAGGATGCAAGAGGGAGGGGGG + Intronic
987724955 5:21686056-21686078 GAATGAGGCAAGTGGAAAGAGGG - Intergenic
987772185 5:22319791-22319813 GAGTGATGGAAGTGGGAAGAGGG + Intronic
988059076 5:26143111-26143133 GAGAGAAGAAAGAGGAAAGAGGG + Intergenic
989792699 5:45425223-45425245 GAGTGATGCACAGGGTAAGAAGG - Intronic
991573253 5:68077378-68077400 GACTGAGGGAAGGGGGAAGAGGG + Intergenic
991733893 5:69614205-69614227 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991810327 5:70469346-70469368 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991860373 5:71007937-71007959 GAGAGAGGAGAGAGGGAAGAGGG + Intronic
993568260 5:89502681-89502703 GAGTGATGCAGGATGAGAGAAGG + Intergenic
993654006 5:90556122-90556144 GAGGGAGGGAAGAGGTAAGAAGG - Intronic
995156188 5:108915983-108916005 GAGTAAAGCAGGAGAGAAGAGGG - Intronic
996134135 5:119818022-119818044 TAGTCATGCAGGAGAGAAGATGG - Intergenic
997028815 5:130098200-130098222 GGGTAAGGCAGGAGGGAAGAGGG - Intronic
997839458 5:137225956-137225978 GCGTGCTCCAAGTGGGAAGAAGG - Intronic
997840429 5:137234441-137234463 GAATGATGAAAGTGGTAAGAAGG - Intronic
998205062 5:140152174-140152196 AAGTGAGGCAAGAGGGATGACGG + Intergenic
998495549 5:142585535-142585557 TAGTGATAGAAGAGGGAAGCTGG - Intergenic
998532616 5:142899744-142899766 GAGAGAAGCAAGGGGGAAGTGGG + Intronic
999018792 5:148139989-148140011 GAGCGATGGGAGAGGGATGAGGG + Intergenic
999259331 5:150228293-150228315 GAAAGAAGCCAGAGGGAAGAGGG + Intronic
999536402 5:152522366-152522388 GATTGATACAAGAGGTGAGAGGG - Intergenic
999585537 5:153085747-153085769 GAGAGAAGGAAGAAGGAAGAAGG + Intergenic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1000829190 5:166082343-166082365 GTCTTATGGAAGAGGGAAGATGG - Intergenic
1001357321 5:171041175-171041197 GAGTGATGCAAGAGAGAGGGTGG + Intronic
1001631838 5:173181219-173181241 GTGTCAAGCAAGAGAGAAGAAGG + Intergenic
1002717286 5:181235465-181235487 GAGTGCTGGAAAAGGGAAGGGGG - Exonic
1002877482 6:1224357-1224379 GAATGACGAAAGAGTGAAGAAGG - Intergenic
1003241008 6:4345819-4345841 AAGTGATCCAAGAGAGAGGAAGG + Intergenic
1004297111 6:14422877-14422899 GAATGAGAAAAGAGGGAAGAAGG - Intergenic
1004881659 6:20014258-20014280 GAGTCACGCTAGAGAGAAGAGGG - Intergenic
1004994280 6:21173128-21173150 GGGGGATGCAGGAGGAAAGAAGG - Intronic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1006225960 6:32536267-32536289 GAGGGATGCTTTAGGGAAGAAGG - Intergenic
1007031460 6:38631521-38631543 AAGTGATGCAAGAGAGAGCAAGG - Intronic
1008286180 6:49654040-49654062 GAGGGAGGGAAGAAGGAAGAAGG - Intergenic
1008832980 6:55791741-55791763 ACGTGGAGCAAGAGGGAAGATGG + Intronic
1009828375 6:68897518-68897540 GAGGGAGGAAAGAGGAAAGAGGG + Intronic
1009828402 6:68897624-68897646 GAGGGAGGAAAGAGGAAAGAGGG + Intronic
1010201241 6:73283993-73284015 GAGTGAGGCTAGAAGCAAGATGG - Intronic
1010800379 6:80168317-80168339 GAGAGAGGGGAGAGGGAAGAAGG + Intronic
1010831926 6:80541520-80541542 GTGGGAGGCAAGAAGGAAGATGG - Intergenic
1011275944 6:85631407-85631429 GAGTGGGGAAAGAGGTAAGAAGG + Intronic
1011717041 6:90117343-90117365 GAGAGAGGGAAGAGGGAAGAAGG - Intronic
1012018851 6:93890197-93890219 GAGTGTTGCAAGAAGGTGGAAGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012482241 6:99680074-99680096 GAATGATGAGAGAGGGAGGAGGG + Intergenic
1013273850 6:108565209-108565231 AAGTGATAAAAGAGGTAAGAAGG + Intronic
1013300703 6:108802702-108802724 GAATGATAAAACAGGGAAGAGGG + Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1015192339 6:130485083-130485105 GAGTGAGGGAAAAGGGAAGTTGG + Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016669878 6:146691885-146691907 GAGGGATGGAAGGAGGAAGAAGG - Intronic
1017380860 6:153827592-153827614 CAGTGAGGCAAGAGAGAACAAGG - Intergenic
1018212018 6:161491260-161491282 GGGTGATGCCTGAAGGAAGAAGG + Intronic
1018420151 6:163634135-163634157 AAGTTATGGAAGAGGGAAGAAGG + Intergenic
1019910624 7:4098627-4098649 GAGGGATGTGAGAGGGAGGATGG + Intronic
1020080236 7:5282843-5282865 GAGAGGAGCGAGAGGGAAGAGGG + Intronic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020690071 7:11343547-11343569 TAGCAATGCAAGATGGAAGATGG - Intergenic
1021412949 7:20348768-20348790 AAGTGTTGCAAGATGGAAGCTGG + Intronic
1021797224 7:24268461-24268483 GAGTGGAGAAAGAGGCAAGAAGG - Intergenic
1022758905 7:33326246-33326268 GAGAGATTCAAGGGAGAAGAGGG - Intronic
1023278995 7:38550681-38550703 GAGTGGTGGGAGAGGGAGGAGGG - Intronic
1024180625 7:46890290-46890312 GAGAGCTGGAAGAGGGAAAATGG + Intergenic
1024195020 7:47050587-47050609 GAGGGTTGAATGAGGGAAGAGGG - Intergenic
1024231371 7:47366521-47366543 GAGTGATGCAAGTGGGTAAAGGG - Intronic
1024263641 7:47590116-47590138 GAGAGATGACAGAGGGAAGGGGG - Intergenic
1024279064 7:47703419-47703441 GAATGATGAAAGATGGAAGAAGG - Intronic
1024741474 7:52359744-52359766 TAGTGATGCAAGTTGGAACAAGG - Intergenic
1024851607 7:53724173-53724195 GAGTGATGAGAGAGAGAAAAAGG + Intergenic
1025796216 7:64739624-64739646 GGGAGAGGGAAGAGGGAAGAGGG + Intergenic
1027505031 7:79005781-79005803 GAGTGATGGACAAAGGAAGATGG - Intronic
1028163167 7:87508789-87508811 GAGAGCTGCAAGGAGGAAGAAGG + Intronic
1028522308 7:91745747-91745769 GATTGATGCAATAGGGAAATAGG - Intronic
1029412782 7:100426667-100426689 GAGGGAGGGAAGAGGGAGGAAGG - Intronic
1029730696 7:102436019-102436041 GTGTGATGGAGGAGGGAGGACGG + Intronic
1031049913 7:116934713-116934735 GAGGGACGGAGGAGGGAAGAAGG - Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031621133 7:123935232-123935254 GAGTGATTGAAGATGCAAGAAGG - Intronic
1031670073 7:124531074-124531096 GAGTCCTGCCAGAGGCAAGAGGG - Intergenic
1032414646 7:131726693-131726715 GAGACAGGGAAGAGGGAAGAGGG + Intergenic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1034228704 7:149502146-149502168 GAGTGATACAGGAGGGAGGCAGG - Intergenic
1034704720 7:153130326-153130348 GAGAGAAGGAAGTGGGAAGATGG - Intergenic
1034809885 7:154122866-154122888 GTCTGATGCCAGAGGGAAGAGGG - Intronic
1034977006 7:155454704-155454726 GGGTGAAGCTAGAGGGAAAACGG + Intergenic
1035971246 8:4251780-4251802 GAGAGATGGAGGAGGAAAGATGG + Intronic
1035971255 8:4251836-4251858 GAGAGATGCAGGAGGAGAGATGG + Intronic
1037591736 8:20318073-20318095 GAGAGAAGGAAGAGGGAAGAGGG - Intergenic
1038749034 8:30279393-30279415 AAGTGATGCAAAAGGGCAAAAGG - Intergenic
1039824525 8:41161732-41161754 GAGGGAGGCAAGAAAGAAGAAGG - Intergenic
1041046793 8:53895159-53895181 GAGTGATGCATGAGGAATCAAGG + Intronic
1041179926 8:55236661-55236683 GAGAGATGCAGGAGGGTAGAGGG - Intronic
1042031736 8:64483684-64483706 TAGTGATGGAGAAGGGAAGATGG - Intergenic
1042188874 8:66165350-66165372 GAGAGATGCAGGAGGCTAGAGGG + Intronic
1042643697 8:70962351-70962373 GAAGGAGGCAGGAGGGAAGAGGG - Intergenic
1043322660 8:79009382-79009404 GAGGGAGGGAAGAGGGAAGGGGG - Intergenic
1043322682 8:79009436-79009458 GAGGGAGGGAAGAGGGAAGGGGG - Intergenic
1045679275 8:104641943-104641965 GAGGGAGGGAAGGGGGAAGAAGG - Intronic
1046057213 8:109093352-109093374 GAGTGAGGCAGGGGAGAAGACGG - Intronic
1046265134 8:111821292-111821314 GTGGGATGGAAGAGGGATGAAGG + Intergenic
1046970328 8:120215822-120215844 GACTGAGGGAAGAGGCAAGAGGG + Intronic
1047416229 8:124666828-124666850 GAGTTTTCAAAGAGGGAAGAGGG + Intronic
1048819062 8:138363077-138363099 GAGAGATGCTAGGGGGAAGAGGG + Intronic
1050035445 9:1431077-1431099 TATTGATGAAAGAGGGAAGGGGG + Intergenic
1050416539 9:5423603-5423625 GAGTGTTTCAAGAAGAAAGAAGG - Intronic
1050840616 9:10143889-10143911 GGGGGATGCAAGAGGGGAGAGGG + Intronic
1051361273 9:16283663-16283685 GAGTGTGGCAAGAGGGAATCAGG - Intergenic
1051850742 9:21504785-21504807 GGGAGATGCAAGAGGAAAAATGG + Intergenic
1052331319 9:27271758-27271780 AAGTCATCCAAGAGGGAAGAAGG + Intergenic
1053288976 9:36867695-36867717 GAGAGATAAAAGAGGGAGGAAGG - Intronic
1053481868 9:38422082-38422104 GAGTGAGGCCAGATGGCAGATGG - Intronic
1053674318 9:40407838-40407860 GAGAGATGAGAGAGGGGAGAGGG + Intergenic
1054510303 9:65968452-65968474 GAGAGATGAGAGAGGGGAGAGGG - Intergenic
1055676610 9:78669029-78669051 GAGTTAGGCAGTAGGGAAGACGG + Intergenic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1056122811 9:83505951-83505973 GAGAAATGCAAAAGGGAAGATGG + Intronic
1056137751 9:83646590-83646612 GAGGGAGGGAAGGGGGAAGAAGG + Intergenic
1056523949 9:87425394-87425416 GGGTGATGAAAGGGGGAAGGAGG + Intergenic
1057957183 9:99419952-99419974 AAGTGATTCAAGAAGGAACAAGG - Intergenic
1059106664 9:111517875-111517897 GAGAGATGCGAGATGCAAGAAGG - Intergenic
1059354398 9:113687808-113687830 GAGGGAAGGAAGGGGGAAGAGGG - Intergenic
1060781839 9:126418757-126418779 GAGAGATGCAGCAGGGAGGAGGG - Intronic
1061458916 9:130720512-130720534 GAGAGATGCAGGAGGTAAAATGG + Intronic
1062146954 9:134994833-134994855 GAGAGATGGAAGAGGAAAGGAGG - Intergenic
1062328242 9:136023050-136023072 GAGGGAGGAAGGAGGGAAGAGGG + Intronic
1185825170 X:3242755-3242777 GCGTGATGCAGGAAGAAAGAAGG + Intergenic
1185924403 X:4130669-4130691 CTGAGATGCAAGAGGGAGGAAGG - Intergenic
1185954880 X:4478380-4478402 AAGGGAGGAAAGAGGGAAGAAGG + Intergenic
1186642404 X:11469998-11470020 AAGGGATGCAGAAGGGAAGATGG + Intronic
1186757288 X:12685348-12685370 GAGAGAAGAAAGAGGGAGGAAGG - Intronic
1186851091 X:13580869-13580891 GAATGATATAAGATGGAAGATGG - Intronic
1186874930 X:13807410-13807432 GAAAGAGGGAAGAGGGAAGAAGG + Intronic
1187309444 X:18127045-18127067 GAGTGATGTAAGAAGAGAGATGG + Intergenic
1189225169 X:39406747-39406769 GAGGGATACATGAGGGAAGCAGG - Intergenic
1189640199 X:43060598-43060620 AAGTGATGCAAAGGGGAAGATGG + Intergenic
1189936432 X:46074093-46074115 GAGGAATGCAGGATGGAAGAGGG - Intergenic
1190363983 X:49674606-49674628 AAGATATGCAAGAGGGAAGCTGG - Intergenic
1190398798 X:50011109-50011131 GAGTGATGCACCAGGTCAGAGGG - Intronic
1190566846 X:51739147-51739169 CAGTGATGCTAGATGTAAGATGG + Intergenic
1191870879 X:65743785-65743807 GAGTCATTAAAGATGGAAGAGGG + Intergenic
1192617978 X:72647691-72647713 GAGTGAGGGAAGAAGTAAGAAGG + Intronic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195658801 X:107358728-107358750 GAGTGAGGAAGGAAGGAAGAAGG + Intergenic
1196039736 X:111189065-111189087 GAGTGAGGAAGGAGGGAGGAGGG - Intronic
1196150080 X:112363904-112363926 GAGGGATGGATGAGGAAAGAAGG + Intergenic
1196520343 X:116664259-116664281 CAGGGATGCAGGATGGAAGAGGG - Intergenic
1197111042 X:122775348-122775370 GAGGAATGCAATAGGGAATATGG + Intergenic
1199264780 X:145817805-145817827 GAGGGAGGCGAGAGGGAGGAGGG - Intergenic
1200978207 Y:9236328-9236350 GAGAGAAGGAAGAGGGAGGAAGG - Intergenic
1201571974 Y:15424387-15424409 GTGCGATGCAAGAGAGAAAATGG + Intergenic