ID: 954697437

View in Genome Browser
Species Human (GRCh38)
Location 3:52435282-52435304
Sequence GGGTGTGCCCAGAGGCAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954697437_954697444 0 Left 954697437 3:52435282-52435304 CCCTCTTGCCTCTGGGCACACCC 0: 1
1: 0
2: 3
3: 38
4: 331
Right 954697444 3:52435305-52435327 GGAAATGTGTTGCGGAAGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
954697437_954697446 20 Left 954697437 3:52435282-52435304 CCCTCTTGCCTCTGGGCACACCC 0: 1
1: 0
2: 3
3: 38
4: 331
Right 954697446 3:52435325-52435347 AGGCCATCTCTGAGAACAAATGG 0: 1
1: 0
2: 1
3: 21
4: 223
954697437_954697441 -8 Left 954697437 3:52435282-52435304 CCCTCTTGCCTCTGGGCACACCC 0: 1
1: 0
2: 3
3: 38
4: 331
Right 954697441 3:52435297-52435319 GCACACCCGGAAATGTGTTGCGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954697437 Original CRISPR GGGTGTGCCCAGAGGCAAGA GGG (reversed) Exonic
900337092 1:2169685-2169707 GGGTGCGCACAGAGGGATGACGG + Intronic
900337111 1:2169738-2169760 GGGTGTGCGCAGAGGGGAGGTGG + Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901402552 1:9024842-9024864 GGCTGCTCCCAAAGGCAAGATGG + Intronic
901507456 1:9694134-9694156 GGGTCTGCCCAGAGGCTGTATGG - Intronic
901632245 1:10653603-10653625 GGGGGTGCCCACAGGCAGGGAGG + Exonic
902067890 1:13703892-13703914 GAGTTTGCCCTGAGGCAATAAGG + Intronic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
903269073 1:22176589-22176611 GGGGGTGCTCAGGGGCAAGGGGG + Intergenic
903537795 1:24078531-24078553 GGGAGCACCCAGAGGAAAGAAGG - Intronic
903887399 1:26548360-26548382 GGGTGGGCCCAGAGGCCAAGGGG + Intronic
904714431 1:32456662-32456684 GGGTGGGCCCAGAAGCCACAGGG + Intergenic
905053743 1:35075592-35075614 GGATGTGCCCAAAGGCAAGGGGG - Intronic
905746655 1:40423954-40423976 GGGTGTACTCAAAGGAAAGAAGG - Intergenic
905920581 1:41716232-41716254 GGGTGAACCCAGAGGCAGGGAGG + Intronic
906543454 1:46605355-46605377 GGGGGTGCTCAGAGGAAGGAGGG + Intronic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
908782276 1:67701234-67701256 GTGAGAGCCCAGAGGAAAGAGGG - Intergenic
910863851 1:91769411-91769433 GTGTGTGCCCAGAGAGAAGTTGG - Intronic
912107784 1:106302926-106302948 GGGAGTCCCCAGCAGCAAGAAGG - Intergenic
912898528 1:113621204-113621226 TGGTGTGCCGAAAGGCCAGAAGG + Intronic
915949192 1:160176601-160176623 TGGTGCGCCCAGAGGAATGAGGG + Exonic
916687725 1:167162306-167162328 GAGTGGGGCCTGAGGCAAGAGGG - Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919926287 1:202193521-202193543 GGCTGTCCCCAAAGGCAAGAGGG + Intergenic
920727570 1:208450465-208450487 GGGAGTGCCGAGAGGGAAGCTGG + Intergenic
921159556 1:212463506-212463528 GGGTGTTCCTAAGGGCAAGAAGG - Intergenic
921193035 1:212726560-212726582 AGATGTGCCCAGAGACAAGGTGG - Intronic
921539877 1:216399897-216399919 AGGTGTGCACAGAGGCCAGGTGG - Intronic
921625589 1:217374750-217374772 GGGTGTGGCCAGATGAAAGCTGG - Intergenic
923874261 1:238030276-238030298 GGGTGTCCACAGTGGCAACAAGG - Intergenic
1062816647 10:505832-505854 AGGTGCGCCCAGAGGAAATATGG - Intronic
1062911416 10:1214899-1214921 AGGAGTGCCCAGAGCCAGGAAGG + Intronic
1063004211 10:1952817-1952839 GGGCGTGTTCAGAGGAAAGAAGG + Intergenic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066195573 10:33096294-33096316 GGATCTGCCCAGATGAAAGAGGG - Intergenic
1066457982 10:35588054-35588076 GGATGTGCCCAGAGCCAGGGTGG - Intergenic
1066978160 10:42388138-42388160 GGATGTGCCCAAAGGCAAGGGGG + Intergenic
1067053326 10:43037616-43037638 GGGGGTTCCCAGAGGCCAGAGGG + Intergenic
1067234426 10:44436172-44436194 GGGTGGGCCAGGAGACAAGAGGG - Intergenic
1067430131 10:46237313-46237335 GGGATTGCTCAGAGGCAAGAGGG - Intergenic
1067657797 10:48210478-48210500 GGGTCTGGGCAGAGGCCAGAAGG + Intronic
1070327157 10:75396601-75396623 GTGAGTCCCCAGAGGCAACAGGG + Intergenic
1070644257 10:78190532-78190554 AGGTGTGCAGAGAGGCAAGCAGG + Intergenic
1073321144 10:102616929-102616951 GGTCATGCCCAGAGGTAAGAGGG - Intronic
1074251001 10:111747260-111747282 GGGTGCCCCCAGAGGCAATGAGG - Intergenic
1075258180 10:120941718-120941740 GGGTGCTCCCATAGGCAGGAGGG - Intergenic
1075730537 10:124632911-124632933 GGGTGTGCCCTGAGGGAACTTGG + Intronic
1076022171 10:127082835-127082857 GGCTGTGTACAGAGACAAGAAGG - Intronic
1076228037 10:128796647-128796669 GTGGCTGCCCAGAGGCACGATGG - Intergenic
1076323364 10:129600663-129600685 GGGGGTGCTAAGAGGCAATACGG - Intronic
1076635157 10:131876773-131876795 GGGTCTGCCCGGAGGGAGGAGGG + Intergenic
1076857547 10:133124707-133124729 GGGTGTTCCCAGCTGCCAGACGG + Intronic
1077152254 11:1077609-1077631 GGGTCTGCCCAGAGGCCTGACGG - Intergenic
1077250693 11:1559391-1559413 GGGTGGGCTCAGAGGCCACAGGG + Intronic
1080336464 11:31203044-31203066 GGGTGAGCACAGAGGAAAGGAGG + Intronic
1081205810 11:40274265-40274287 GGATGTGGCCAGAGGCTTGACGG - Intronic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1082806845 11:57457239-57457261 GGGTATGCCCAGAGGGAAGGGGG + Intergenic
1083309839 11:61778510-61778532 GAGGGAGCCCAGAGGCAAGTGGG + Intronic
1083464190 11:62834336-62834358 GGATGAGACCAGAGGCAAGTGGG + Intronic
1083853361 11:65380233-65380255 GTCTGTGCCAAGAGGAAAGAGGG + Intronic
1084275626 11:68049709-68049731 GGGTGTGCCAAGCAGCAGGATGG - Exonic
1084410533 11:69003830-69003852 GGGGCTGACCAGAGGCAAAAGGG + Intergenic
1084417717 11:69043057-69043079 AACTGAGCCCAGAGGCAAGAAGG - Intergenic
1085174999 11:74478219-74478241 TGGTGTGACCAGAGACAAGCAGG - Intergenic
1085296359 11:75433932-75433954 GGGTGTGACCTGAGGGAAAAGGG - Intergenic
1085896389 11:80644565-80644587 GAGTGTCCCCACTGGCAAGAAGG + Intergenic
1086745790 11:90425188-90425210 GGGAGTCCCCAGAGGCAAGATGG + Intergenic
1089256224 11:117195712-117195734 AGGGGTGCCCAGGAGCAAGATGG + Intronic
1089637663 11:119826510-119826532 CTGGGTGCCCAGAGGCAACATGG + Intergenic
1090641980 11:128737630-128737652 TGGGGTACCCTGAGGCAAGAGGG - Intronic
1091402836 12:191046-191068 GGGTGTGGCCAGAGGCCAGGCGG - Exonic
1094414803 12:30205151-30205173 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1094414814 12:30205269-30205291 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1094427192 12:30328006-30328028 GGGTGTGCCCAGGAGCAGGCAGG + Intergenic
1095323173 12:40854878-40854900 GAACGAGCCCAGAGGCAAGAGGG + Intronic
1095665106 12:44788567-44788589 GAGGGTGCCCAGAGGCATGGGGG + Intronic
1096673743 12:53215213-53215235 GGGAGTGGCCAGAGGAAAGAGGG + Intronic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1101349140 12:103912098-103912120 GGGTGTCTCCAGAGACAGGAGGG - Intergenic
1102031355 12:109741774-109741796 GGGTGTGCTGGGAGGCAAGGAGG + Intronic
1102032743 12:109752479-109752501 GGTTCTGCCCAGGGGCAACAGGG - Intronic
1102531733 12:113551666-113551688 GGGTGGGCACAGAAGGAAGAAGG - Intergenic
1102644556 12:114395752-114395774 GGGTGTTCCCAGGGACAAGAGGG + Intronic
1102730212 12:115102574-115102596 GACTGTCCCCAGAGGCAAGGTGG + Intergenic
1103134417 12:118495260-118495282 GGGAAAGGCCAGAGGCAAGAAGG - Intergenic
1103740633 12:123088909-123088931 GGCTGAGACCAGAGGCAAGGTGG - Intronic
1104007606 12:124904975-124904997 GGGAGTGACCGTAGGCAAGAGGG - Intergenic
1105545445 13:21347585-21347607 GGCTGTGCCCAGAGCCAAGGAGG - Intergenic
1105701662 13:22939401-22939423 GGCTGTTTCCAGAGGCAAGCTGG - Intergenic
1105854280 13:24361171-24361193 GGCTGTTTCCAGAGGCAAGCTGG - Intergenic
1108525365 13:51281319-51281341 TGGTGTGCTCAGTGGCCAGAGGG - Exonic
1109368942 13:61396500-61396522 TGGGGTGCCCAAAGGGAAGAAGG + Intergenic
1110860648 13:80341586-80341608 AGGTTTGCCCAGAGGCAATGAGG + Intergenic
1111546887 13:89749693-89749715 GGAAGTACCCAGAGCCAAGAAGG + Intergenic
1112146489 13:96705817-96705839 GCCTGTGCCCAGAGGCCAGTGGG - Intronic
1112636427 13:101222633-101222655 GGATGTGCCCAAAGGCAAGGGGG - Intronic
1113766070 13:112881857-112881879 GGCTCTGCAGAGAGGCAAGAGGG - Exonic
1113947007 13:114050031-114050053 GGCTGAGCCCGGAGGCAGGAGGG + Intronic
1114394522 14:22344934-22344956 GGTGGTGCTAAGAGGCAAGAGGG - Intergenic
1114582429 14:23774586-23774608 AGGTGTGCACAAAGGCAGGAAGG + Intergenic
1114613882 14:24058301-24058323 GGGTCAGCACAGAGGCTAGATGG - Intronic
1114617467 14:24075900-24075922 GGGAGGGCACACAGGCAAGAGGG + Intronic
1115141643 14:30178185-30178207 TGCTGGGGCCAGAGGCAAGAGGG - Intronic
1119977659 14:79043350-79043372 GCGTGAGCCCAGAGTCCAGAAGG + Intronic
1120377260 14:83725985-83726007 GGGTCTGCCCAAAGCCATGAGGG - Intergenic
1121291215 14:92777140-92777162 CCTTCTGCCCAGAGGCAAGAAGG - Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1121813689 14:96913169-96913191 GCGTCTGCCCATAGGAAAGAAGG - Intronic
1122133768 14:99620820-99620842 GGGTGTCCCCAGAGGGAAATGGG - Intergenic
1122364272 14:101185292-101185314 GGGGGTGCCCAGAGCCACCATGG + Intergenic
1122575419 14:102738810-102738832 GGATGTGGCCAGAGGAATGAGGG - Intergenic
1122843085 14:104476194-104476216 GGCTGTTTCCAGAGGCAAGTTGG - Intronic
1122856763 14:104563760-104563782 AGGGGTCCCCACAGGCAAGAGGG - Intronic
1122920879 14:104879644-104879666 GGGGGTGGCCAGAGGCAGGAAGG + Intronic
1123435149 15:20248917-20248939 GGGTGTGTCCAGGGGCAGAAAGG - Intergenic
1123995512 15:25715571-25715593 GGCAGAGCCCAGAGGCCAGATGG + Intronic
1124063660 15:26319625-26319647 GGGGATGCAGAGAGGCAAGAGGG + Intergenic
1125717576 15:41827931-41827953 GTGTGTGTCCAGGGGCAGGACGG + Intergenic
1126878770 15:53072195-53072217 GAGAGTGGCCAGTGGCAAGAAGG + Intergenic
1129110734 15:73335659-73335681 GGGTGGGCACAGAGGCAGAATGG + Intronic
1129245672 15:74277380-74277402 GGGTGGGCCCAGGGGAAATAAGG + Intronic
1129742169 15:77994564-77994586 GGGTGTGCCCAGTGGCAGCTGGG + Intronic
1132065020 15:98723915-98723937 TAGTGTGCCCAGAAGCCAGAAGG + Intronic
1132684475 16:1156567-1156589 GGGTGTGTCCCGTAGCAAGAGGG + Intronic
1132717888 16:1301240-1301262 GGGGGCGGGCAGAGGCAAGAGGG - Intergenic
1132756668 16:1488520-1488542 AGGTGGGGCCAGAGGCTAGAAGG - Intronic
1132945686 16:2530449-2530471 GGCTGTCCTCAGAGCCAAGAGGG - Exonic
1136187746 16:28597956-28597978 GCGTGAGCTCAGAGGCAAGCGGG + Intergenic
1136487941 16:30585330-30585352 CGGTGTCCCCAGAGGCTAGTGGG - Intronic
1136565176 16:31065470-31065492 AGGTGTGCCCAGAGGCTAGGGGG + Intronic
1136692100 16:32039687-32039709 GGGTGTGCTCAGAACCACGAGGG + Intergenic
1136792643 16:32983125-32983147 GGGTGTGCTCAGAACCACGAGGG + Intergenic
1136849450 16:33602035-33602057 GGGTGTGTCCAGGGGCAGAAAGG + Intergenic
1136877213 16:33870929-33870951 GGGTGTGCTCAGAACCACGAGGG - Intergenic
1137719907 16:50621866-50621888 GGGTCTGCCCTGAGCCAGGACGG - Intronic
1137881212 16:52050361-52050383 GGGTTAGCCCAGATCCAAGAGGG - Intronic
1139377764 16:66511084-66511106 TGGTTTGCCCAGAGCCAAGCTGG - Exonic
1139504568 16:67392532-67392554 GGGTGTGGCCAGAGGGCTGAGGG - Intronic
1140063011 16:71587778-71587800 GGGCATGGCCAGAGGCAAGAGGG - Intergenic
1140461802 16:75146017-75146039 GGGGGAGCACAGAGGCAAGTGGG - Intergenic
1141023143 16:80516900-80516922 GGTGGTGGCCAGTGGCAAGATGG - Intergenic
1141213124 16:81999539-81999561 AGGGCTGCCCAGAGGCAATATGG + Exonic
1142183664 16:88684339-88684361 GGCTGAGCCCAGAGGCAGGACGG + Intronic
1142213148 16:88817856-88817878 GCGTGTGCTCTGAGGCACGAGGG + Intronic
1142411452 16:89919114-89919136 GGGGGTGCCCAGATGGAAGGAGG + Exonic
1142441788 16:90103188-90103210 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
1203094858 16_KI270728v1_random:1244604-1244626 GGGTGTGCTCAGAACCACGAGGG + Intergenic
1203111158 16_KI270728v1_random:1450685-1450707 GGGTGTGTCCAGGGGCAGAAAGG + Intergenic
1142728050 17:1830623-1830645 GGGTGTGACCTGAAGCAAGCAGG - Intronic
1142969476 17:3601425-3601447 GGGTGTGCCCAGGTGACAGAAGG - Intergenic
1143261253 17:5599925-5599947 GGGTGGGCTCAGCGGCCAGATGG + Intronic
1143390887 17:6558556-6558578 AGCTGTGCCCAGAAGCAGGAGGG - Intergenic
1143456993 17:7074690-7074712 TGGACTGCCCAGAGGCATGAGGG + Exonic
1143709143 17:8721874-8721896 GGGTGAGAACAGAGGCAAGCAGG - Intergenic
1143786338 17:9258572-9258594 GGGTGTGATCAGAGGCAGGTAGG - Intronic
1144852794 17:18252405-18252427 GGGTGTGCCCTGGAGCAAGGGGG - Intronic
1147857575 17:43493945-43493967 GGGTGTGCCCTGGAGCACGATGG + Intronic
1148139655 17:45318998-45319020 TGGTGTGCCCAGAGGCAAACAGG - Intergenic
1148326119 17:46784443-46784465 CCGTGTGCCCACAGCCAAGATGG - Intronic
1148457395 17:47818392-47818414 GGGTGAGCCCAGGGTCAGGAAGG + Intronic
1151349764 17:73524913-73524935 TGATGTGCGCAGAGGCGAGATGG - Intronic
1151564767 17:74891996-74892018 GGGCGTGCCCGAAGGTAAGAAGG + Intronic
1151830025 17:76544194-76544216 GCGTGTGCACAGAGGCACGGGGG - Intronic
1152350195 17:79779840-79779862 GCGTGTGCCATCAGGCAAGAAGG + Intronic
1152820874 17:82437074-82437096 GGCTGTACCCAGAGCCAACATGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156264087 18:35470257-35470279 GGGGGTTCCCAGTGGCAAAATGG - Intronic
1156451244 18:37267524-37267546 GGGACTGCCCAGAGGGAGGATGG + Intronic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157767129 18:50307758-50307780 GGGTGCGCCCGGAGCTAAGAAGG + Intergenic
1161341790 19:3746985-3747007 GACTGTGGCCAGAGTCAAGATGG + Intronic
1163405168 19:17117418-17117440 GGGAGTGCCCAGAGGCAGCTTGG + Intronic
1163686553 19:18715121-18715143 GGGAGCCCCCAGAGGCAGGAGGG - Intronic
1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG + Intergenic
1164625640 19:29725902-29725924 GGGACTGCACAGAGGCATGAAGG + Intergenic
1165012445 19:32858642-32858664 GGCTGTGCCCCGAGGCGAGGTGG - Intronic
1165030952 19:32997910-32997932 GGGTGTGCCTGGAGGCAGGGAGG + Intronic
1165109641 19:33494187-33494209 GGGGGTGCTCAGAAACAAGAGGG - Intronic
1166295541 19:41887683-41887705 GGCACAGCCCAGAGGCAAGAGGG - Intronic
1166587594 19:43964363-43964385 GGATGTGCTCTGAGGCATGATGG + Intronic
1167829540 19:52008225-52008247 GCGTTTGCGCAGATGCAAGATGG + Intronic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
925451426 2:3972942-3972964 AGCTGGTCCCAGAGGCAAGATGG + Intergenic
925922500 2:8646977-8646999 GGGTCTGCCCTGAGTCAAGATGG + Intergenic
926061138 2:9805933-9805955 GGGGGAGCCCAGAGACAAGGGGG - Intergenic
928980561 2:37131815-37131837 GGATGTGCCCAAAGGCAAGGGGG - Intronic
931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG + Intronic
932129967 2:69178540-69178562 GGGAGGGGCCAGCGGCAAGAGGG + Intronic
932129976 2:69178560-69178582 GGGAGGGGCCAGGGGCAAGAGGG + Intronic
932377820 2:71253768-71253790 TGGTGTGCCCATGGGCAAGTGGG - Intergenic
932631163 2:73344644-73344666 TGGTGGGACAAGAGGCAAGAGGG - Intergenic
933922942 2:87066776-87066798 AGGTTTGACTAGAGGCAAGAAGG - Intergenic
934609848 2:95727021-95727043 GGGTGAGCCCAGAGGCTGGGAGG + Intergenic
934699054 2:96423908-96423930 GGGGGTGGACAGAGGCAGGAGGG - Intergenic
936543174 2:113368594-113368616 GGGTGAACCCAGAGGCTGGAAGG + Intergenic
937103060 2:119286466-119286488 TGGTGTGCCCAGAGAGAACAGGG + Intergenic
938065682 2:128280855-128280877 GTGTGTGTCCTGAGGCAAGAGGG - Intronic
938675823 2:133632952-133632974 CGGTGTGTCCAGATGCAAGCTGG - Intergenic
938964805 2:136378952-136378974 GGGTTTGCCCAGCCACAAGATGG - Intergenic
942192425 2:173483342-173483364 GGGTGTGACCAGCCTCAAGAGGG - Intergenic
945167831 2:206965009-206965031 TGCTGTGGCCAGAGGCTAGAAGG + Intronic
945804915 2:214478741-214478763 GGGTGTTCCTCAAGGCAAGAGGG - Intronic
947712358 2:232323423-232323445 GGAAGTCCCCAGAGGCTAGATGG - Intronic
948246971 2:236494887-236494909 GGGTGTGGCCTGAGGAGAGAGGG + Intronic
948277273 2:236718800-236718822 GGGTGAGCCGAGAGACAAGCCGG - Intergenic
948474610 2:238209089-238209111 GGATGTGCCCAAAGGCAAGGGGG + Intergenic
948671474 2:239571354-239571376 GGCTGTGCTCAGAGGCCAGCAGG - Intergenic
948914002 2:241021057-241021079 AGGTGTTCCCATAGGGAAGAAGG - Intronic
949063888 2:241977595-241977617 GGGTGTGCTCAGTGGGACGAGGG + Intergenic
1168880057 20:1198827-1198849 GGAGGTGCCCAGAGGGAAGGTGG - Intergenic
1169210024 20:3760615-3760637 GGGTGCGGTCAGAGGCAACAGGG + Intronic
1169229065 20:3874931-3874953 GGGTGAGCCCAATGGCTAGAGGG + Exonic
1169303615 20:4469298-4469320 TGGTTTGCCCAGAGGCAATGGGG + Intergenic
1170572912 20:17642442-17642464 AGGTGTGCCCTGAGGCCAGTGGG - Intronic
1171324227 20:24276653-24276675 AGGTGTGCTTAGAGGCAAGAGGG + Intergenic
1171335218 20:24379431-24379453 GAGTTTGGCAAGAGGCAAGAAGG - Intergenic
1171823594 20:29876134-29876156 GGGTGTGCTCCGAGGCATCAGGG - Intergenic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172955623 20:38756111-38756133 GGTTGTGCCCAGAGTCAGGAGGG + Intronic
1173582387 20:44156644-44156666 GGGAGTGCCAAGAGACAAAAAGG + Intronic
1175641404 20:60633578-60633600 GTGTGTGCCCAGAGGCCAGCAGG + Intergenic
1175824909 20:61931516-61931538 GGGTGAGCCCGGAGGCGAGAGGG - Intronic
1175851830 20:62097828-62097850 GGGTGTTGCCAGAGGCAGGGTGG + Intergenic
1176239448 20:64069155-64069177 GGGTGTGCCCAGCAGCCAGGAGG - Intronic
1176257729 20:64160843-64160865 GGGTGTGTGCAGAGGCCAGCTGG + Intronic
1178974150 21:37207681-37207703 GGGCCTGGCCAGAGGCAGGAAGG - Intergenic
1179436833 21:41368190-41368212 GGCTATGCACAGAGGCAGGAGGG - Intronic
1179585436 21:42371239-42371261 GGGAGTGGCCAGTGGCAGGAAGG - Intergenic
1179830248 21:43992033-43992055 GAGTGTGCGCAGTGGCAAGGGGG + Intergenic
1179874576 21:44261585-44261607 GGCTGGGCCCAGAGGAAAGCAGG - Intronic
1180022229 21:45135780-45135802 AGGTGTGGCCACAGTCAAGAGGG + Intronic
1180259192 21:46656176-46656198 GGGTGGGAGCAGAGGCAAGTGGG - Intronic
1180598245 22:16993952-16993974 GGGTGTTCACAAATGCAAGAAGG - Intronic
1180819696 22:18817594-18817616 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181019762 22:20093489-20093511 GGGTGTGCCTAGAGCCAACTGGG + Intronic
1181205921 22:21252039-21252061 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1182708945 22:32308377-32308399 GGGTGTGGACAGCGGCTAGAGGG + Intergenic
1182760859 22:32721273-32721295 GGGTGGGCACAGAGGAAAGAGGG + Intronic
1183017125 22:34997998-34998020 GGAAGAGCCCAGAGGGAAGATGG + Intergenic
1183712144 22:39511306-39511328 TGGTGAGCGCAAAGGCAAGAAGG + Exonic
1184224389 22:43120823-43120845 GCCTGGGCCCAGAGGCCAGATGG + Intronic
1203221000 22_KI270731v1_random:43374-43396 CGGTCTACACAGAGGCAAGAAGG - Intergenic
1203269825 22_KI270734v1_random:43447-43469 CGGTCTACACAGAGGCAAGAAGG + Intergenic
949800483 3:7898363-7898385 TGGTGTGCACAGAGACAAGAGGG - Intergenic
950426312 3:12926569-12926591 AGGTGTGCCATGAGGCAAGGGGG - Intronic
950965200 3:17141260-17141282 TGGTGTGCCCAGAGCCTGGAGGG + Intergenic
952832421 3:37576213-37576235 CTGTGTGCCCAGCTGCAAGAAGG - Intronic
952834858 3:37594038-37594060 GGGTGAGCCCAGTGGCAAAGTGG - Intronic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
954914143 3:54134761-54134783 GGATGCTCCCAGAGGCAAGGAGG - Intronic
956151812 3:66251517-66251539 GGCTGGGCCCACTGGCAAGATGG - Intronic
960691021 3:120347031-120347053 GGGAAAGCCCAGAGGCAAGGAGG - Intronic
961262498 3:125613683-125613705 GAGTGTGCCAAGAGCCCAGAGGG - Intergenic
961558794 3:127714733-127714755 GAGTGTGCAAAGAGGCAGGAGGG + Intronic
963015306 3:140818786-140818808 GTGTGGGCCCAGAGGTAAGGTGG + Intergenic
964202813 3:154137346-154137368 GAGTGTCCCCACCGGCAAGAAGG + Intronic
964761069 3:160135603-160135625 GGGTGGGCACAGACCCAAGAGGG - Intergenic
964900101 3:161648269-161648291 GGCTGTTCCCAGAGCCCAGAAGG + Intergenic
965475227 3:169147833-169147855 GTGTGTGCACCGAGGCAGGAGGG + Intronic
966856960 3:184201023-184201045 GGGTGTGCTCAAAGGCATGAGGG - Intronic
966894992 3:184437888-184437910 GGGTGTCCCCACCAGCAAGAAGG + Intronic
967293866 3:187947143-187947165 GGCTGTGCCCAGATGCCAGCTGG + Intergenic
967566022 3:190973120-190973142 GGGAGTGCCTATAGGCTAGAGGG - Intergenic
968362053 3:198154155-198154177 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
968548066 4:1208554-1208576 GGTAGGGCTCAGAGGCAAGAGGG - Exonic
968647107 4:1746548-1746570 GGGTGTCCCCAAGGGCATGAGGG + Intergenic
968950261 4:3687841-3687863 GCGTGAGCCGAGAGGCCAGAAGG + Intergenic
969478828 4:7436181-7436203 GGGTGTGCTCAGCTGCAGGATGG + Intronic
971412088 4:26384892-26384914 GGGAGAGGCAAGAGGCAAGAGGG - Intronic
972746190 4:41935063-41935085 AGCGGTGCCCAGAGGCATGACGG - Intergenic
974236937 4:59193501-59193523 TGGTATGCCCAGAGGGTAGAAGG + Intergenic
976268047 4:83203975-83203997 GGATGTGTCCAAAGGCAAGGGGG - Intergenic
977179493 4:93856884-93856906 GGATGTGCCTGGAGCCAAGAGGG + Intergenic
984231801 4:177109379-177109401 GAGTGTTCCTACAGGCAAGAGGG + Intergenic
984935648 4:184887677-184887699 GGGTGGTCCCAGAGGTGAGAAGG - Intergenic
988878388 5:35473338-35473360 GGCTGGGCCTTGAGGCAAGAGGG - Intergenic
991261978 5:64677386-64677408 GAGGCTGCCCAGAAGCAAGAGGG - Intergenic
994816693 5:104594824-104594846 GGATGTGCCCAAAGGCAAGAGGG - Intergenic
995075451 5:107978196-107978218 GTGTGTGGCTAGAAGCAAGATGG - Intronic
995460676 5:112399791-112399813 GGCTGAGCCCAGAGGCAAAGAGG - Intronic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
997653589 5:135539341-135539363 GGGTGAACCCAGTGGAAAGAGGG + Intergenic
997813335 5:136993411-136993433 GCGTATGCCCTGAGGGAAGAGGG - Intronic
998146909 5:139734199-139734221 GGGTTTGCACAGAGGCTGGAGGG + Intergenic
1000240701 5:159405683-159405705 GCCTGTCCCCAGAGACAAGAAGG + Intergenic
1001329214 5:170750541-170750563 GGCTTTGCCCAGAGCCCAGATGG + Intergenic
1002809432 6:612981-613003 GGAGGTGCCCAGAGGCACCAAGG + Intronic
1003406180 6:5828902-5828924 GGCTGTGCCCAGAGCCAAGGAGG + Intergenic
1003838417 6:10095171-10095193 TGGTGGGCCCAGAGGGAGGAAGG + Intronic
1004046078 6:12024918-12024940 GGGAAGGCCCAGTGGCAAGAGGG + Intronic
1005421375 6:25654878-25654900 TGGTCTGACCAGAGGAAAGAAGG - Intronic
1005867869 6:29949791-29949813 GTATGTGCCCAGAGACAAGCAGG + Intergenic
1006146842 6:31964393-31964415 GGGGCTGCCCAGAGGGCAGAGGG + Intronic
1006816611 6:36855351-36855373 GGGCGTGCACAGAGTTAAGAGGG + Exonic
1006924246 6:37645781-37645803 GGGTAGGGCCAGAGGCTAGAAGG - Intronic
1007749390 6:44062853-44062875 GGGAGAGGGCAGAGGCAAGATGG - Intergenic
1008545151 6:52577189-52577211 GCGCGTGCCCAGCGGCTAGAGGG - Intergenic
1012249823 6:96967850-96967872 GGGCATGCCCTGAGGCAGGAAGG + Intronic
1012436059 6:99216166-99216188 AGGACTGGCCAGAGGCAAGAGGG - Intergenic
1012860510 6:104553730-104553752 GGTTGTTACCAGAGGCAGGAGGG + Intergenic
1013465496 6:110414090-110414112 GGTTGTGCCCATAGGGAAAATGG - Intronic
1014459024 6:121673092-121673114 TGGTGTCCCCAGTGGCAGGACGG - Intergenic
1015825739 6:137309576-137309598 GAGTGTGCTCAGAGTCAGGAGGG + Intergenic
1016996659 6:149965909-149965931 GGGTGTGTCCTCAGGCAAAAGGG - Intronic
1017002140 6:150004338-150004360 GGGTGTGCCCTCAGGCAAAAGGG + Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1019253627 7:34552-34574 CGGTCTGCCCAGAGGCCAGCAGG - Intergenic
1019532734 7:1511733-1511755 GGGTGGGCCCAGAGGACAGGCGG - Intergenic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1025003723 7:55339454-55339476 GGGTGTGCCCAAGAGCAGGAGGG + Intergenic
1025784430 7:64631717-64631739 GGTTCTGCCCACAGGGAAGACGG + Intergenic
1026335034 7:69386838-69386860 GGTTGTCCCCAGCTGCAAGAGGG - Intergenic
1028983964 7:96995809-96995831 GGGTCAGCCAGGAGGCAAGAAGG + Intergenic
1029139765 7:98401248-98401270 GGGCGTGGCCAGAGGGAAGCGGG + Intergenic
1029504067 7:100951512-100951534 GGGTGTGACCAGAGGAGGGAAGG + Intronic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1032258589 7:130316411-130316433 GGATGTGCCCAAAGGCAAGGGGG + Intronic
1032441258 7:131944735-131944757 GGGATTGTCCAGAGGTAAGAGGG + Intergenic
1033372207 7:140719800-140719822 GGGCGTGCCCAGTGAAAAGATGG - Intronic
1034851234 7:154495840-154495862 GTGTGTACCCAGATGCAGGAAGG + Intronic
1035400706 7:158563635-158563657 GGGTGTGCCCTGAGCTAACAAGG - Intronic
1035836160 8:2754410-2754432 GGGTGGGGCCAGAGGGTAGATGG + Intergenic
1036446966 8:8829885-8829907 AGAGGTGCCCAGAGGCCAGATGG + Intronic
1037824986 8:22155655-22155677 GGGTGCCCCAAGAGGCAATAGGG - Intronic
1037828663 8:22175731-22175753 TGGTGTTCCCAAGGGCAAGAAGG - Intronic
1038118983 8:24590601-24590623 GGTTGGGCCCAGATACAAGAGGG + Intergenic
1040618383 8:49062746-49062768 TGGTGTTCCCAGGGCCAAGACGG + Intronic
1042146264 8:65733276-65733298 GGGTGTGCCCAGAGGGAGATGGG + Intronic
1043019291 8:74981372-74981394 AGGTCTGTCCAGAGGCAACAAGG + Intergenic
1043531788 8:81159363-81159385 GCCTGCTCCCAGAGGCAAGAGGG - Intergenic
1043827697 8:84949006-84949028 TGGTATGGCCAGAGGCTAGACGG - Intergenic
1043980071 8:86627752-86627774 TTGTGTGCCCTGAGGCAGGATGG + Intronic
1046013224 8:108575251-108575273 GGTGGTGAGCAGAGGCAAGAAGG + Intergenic
1046337299 8:112806984-112807006 TGGTCTGGCCAGAGGCAACAGGG - Intronic
1048767696 8:137862714-137862736 GGCTGTGCCCATAAGCAAGGTGG - Intergenic
1049239362 8:141529091-141529113 GGGAGTGCCTAGAGGCAGGGAGG - Intergenic
1049262317 8:141646355-141646377 GGGGGTGCCGAGAGGCAGGGGGG - Intergenic
1049392342 8:142378700-142378722 GGGGTTGCCCAGAGGTAACAAGG + Intronic
1050261666 9:3847254-3847276 GGAAGTGCCCAGAGAAAAGAGGG + Intronic
1051355936 9:16239878-16239900 GGGTGAGCCCAGGGCCAGGATGG - Intronic
1053046948 9:34927638-34927660 GGATGTGCCCAGAGTCAGGAAGG - Intergenic
1053412533 9:37925055-37925077 ATGTGTGCCCAGAGGCCAGAGGG - Intronic
1056239987 9:84635407-84635429 GGGTGTGCACAGAGGTAGGGTGG + Intergenic
1056939954 9:90946516-90946538 AGGTGTGCCTAGCGGAAAGAAGG - Intergenic
1057076508 9:92140985-92141007 GGCTATCCCCAAAGGCAAGAGGG + Intergenic
1057179699 9:93023124-93023146 TGCTGTGCCCAGATGCAGGAGGG + Intronic
1058900554 9:109438790-109438812 GGATGTGCTCAGAGGCCACAGGG + Intronic
1058973095 9:110100950-110100972 GAATGTTCCCAGAGCCAAGATGG + Intronic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1061002175 9:127908618-127908640 GGGTGTGGCCGGAGGCGAGTGGG - Intronic
1061465894 9:130779393-130779415 GGGGCAGCACAGAGGCAAGAAGG - Intronic
1061819900 9:133221383-133221405 GGGTGTGCACAGATGCAGGGAGG + Intergenic
1061955851 9:133960947-133960969 TGGTGAGCACAGAGGCAGGAGGG + Intronic
1062049986 9:134442311-134442333 GGCTGTGCCCAGAGTCCAGGGGG - Intergenic
1062240756 9:135536565-135536587 GGGTGTGCACAGATGCAGGGAGG - Intergenic
1062746741 9:138217817-138217839 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
1186409686 X:9335912-9335934 GGGAGAGTCCAGAGGCAAGGAGG + Intergenic
1188151705 X:26684508-26684530 GGGTGTGCCCTCAAGCAAGAAGG - Intergenic
1189614161 X:42767060-42767082 GGATGTGCCAAAAGGCAAGGGGG - Intergenic
1190072287 X:47289358-47289380 GGATGTGCCCAAAGGCAAAGGGG + Intergenic
1192573716 X:72226368-72226390 GGATATGCCCAAAGGCAAGGGGG - Intronic
1196174630 X:112627356-112627378 GCGTGTGACCTGAGCCAAGATGG - Intergenic
1197278578 X:124508830-124508852 GGGTCTGCCCAGAGAGAGGAGGG - Intronic
1199787471 X:151117833-151117855 CTGTGAGCCCACAGGCAAGAAGG - Intergenic
1200096803 X:153668439-153668461 AGGGGTGCCCACAGGCAACAAGG + Intergenic
1201073447 Y:10170067-10170089 GGGTGTGCTCGGAGGCATCAGGG - Intergenic