ID: 954700285

View in Genome Browser
Species Human (GRCh38)
Location 3:52447247-52447269
Sequence CTGTGTCAGGCCCTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 1, 2: 12, 3: 98, 4: 536}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954700285 Original CRISPR CTGTGTCAGGCCCTGTGTTG GGG Intergenic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900534339 1:3169608-3169630 CTCTGTCAGCCTCTTTGTTGAGG - Intronic
900608123 1:3532836-3532858 CTGTGCCAGGCCCTGGGTTCTGG + Intronic
901739220 1:11331188-11331210 CTGTGCCAGGCTCTGTGTCGAGG + Intergenic
901807455 1:11747583-11747605 CTATGTCTTGCCCTGTGCTGCGG - Intronic
901850540 1:12012149-12012171 CTGAGGCGGGCCCTGTGCTGGGG + Exonic
902396786 1:16136252-16136274 ATGTGCCAGCCCCTGTGATGGGG - Intronic
902447139 1:16474552-16474574 CTGGGTTAGGCCCAGAGTTGGGG - Intergenic
902466999 1:16624531-16624553 CTGGGTTAGGCCCAGAGTTGGGG - Intergenic
902507599 1:16948245-16948267 CTGGGTTAGGCCCAGAGTTGGGG + Intronic
902541433 1:17158355-17158377 ATGTGCCAGGCTCTGTGCTGGGG + Intergenic
903188396 1:21642344-21642366 CTGTGCCAGGCCCTGGTTTCAGG + Intronic
903862585 1:26373831-26373853 CTGTGTCTGGCACTGTGCTAGGG + Intronic
903972269 1:27126697-27126719 ATGTGTCAGGCTCCGTGCTGAGG - Intronic
904038695 1:27572062-27572084 CCCTGTCAGGCCTTGAGTTGGGG - Intronic
904046303 1:27610963-27610985 CTGTGTCCTGCCCTGTGCTGGGG - Intergenic
904052913 1:27651004-27651026 ATGTGCCAGGCCCTGTGCTAGGG + Intergenic
904371102 1:30047872-30047894 GTGTGTCAGGCACTGTGAAGGGG - Intergenic
904609713 1:31718749-31718771 CTGTGTCTGTGCCTGTGGTGGGG - Intergenic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
904925468 1:34044153-34044175 ATTTGTCAGTCTCTGTGTTGGGG - Intronic
905242144 1:36588262-36588284 GTGTGCCAGGCCCTGAGCTGGGG - Intergenic
905284951 1:36873185-36873207 GAGTGCCAGGCCCTGTGCTGGGG - Intronic
905537709 1:38736272-38736294 CTGAGTCCAGGCCTGTGTTGGGG - Intergenic
905886490 1:41494718-41494740 CTGTGTCAGGCCCAGGGCTGGGG + Intergenic
906071891 1:43022941-43022963 ATGTGCCAAGCCCTGTGATGGGG + Intergenic
906390689 1:45412976-45412998 CAGAGTGAGGCCCTGTCTTGGGG + Intronic
906704727 1:47886711-47886733 CACTGCCAGGCCCTGTGTTAGGG + Intronic
906742879 1:48199446-48199468 ATGTGTCTGGCACTGTGCTGGGG + Intergenic
907241709 1:53084618-53084640 CTGTGTCAGCCCGTGTCATGTGG - Exonic
907247392 1:53116788-53116810 CTGGGTCTGGCCCTGAGTTCTGG - Intronic
907328911 1:53658837-53658859 CTGGGTGGGGCCCTGTATTGGGG - Intronic
907354398 1:53860610-53860632 CTGTGCCAGGCCCTGTGCAGGGG - Intronic
907395211 1:54184987-54185009 CTGTGCCAGGCACCATGTTGAGG + Intronic
907423336 1:54362394-54362416 CTTTGCCAGGCCCTTTCTTGGGG - Intronic
907476256 1:54707685-54707707 GTATGTCAGGGCCTGTGCTGGGG + Intronic
907707317 1:56844081-56844103 CTGTGCCAGGCAGTGTGCTGGGG + Intergenic
908776811 1:67648645-67648667 CTGTGCCACGCCCTGTGCTGGGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
908924642 1:69239539-69239561 CTTTGCCAAGCCCAGTGTTGAGG + Intergenic
910601351 1:89035746-89035768 ATGTGTCAGGCACTGATTTGAGG - Intergenic
914198463 1:145463494-145463516 CTGAGTCAGTCCCTGAGTGGGGG - Intergenic
914477569 1:148036622-148036644 CTGAGTCAGTCCCTGAGTGGGGG - Intergenic
914513972 1:148357909-148357931 CTGAGTCAGTCCCTGAGTGGGGG - Intergenic
915559959 1:156681380-156681402 CTTTGGCAGGCCCTGCCTTGAGG - Intergenic
916582329 1:166120148-166120170 CTGTGCCAGGTGCTGTGCTGGGG + Intronic
916722283 1:167493476-167493498 CTGTGCCAGGCCCTGTGCTGAGG + Intronic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
916932967 1:169598765-169598787 ATGTGTCAGGCCCTGTTCTCTGG - Intronic
918438948 1:184546469-184546491 CTGTGCCAGACCCTGTGTTAGGG + Intronic
918908849 1:190537942-190537964 ATGTGTCTGGCCCTTTTTTGAGG - Intergenic
919078446 1:192840319-192840341 CTGTGTCAGGCACTGGGTTAAGG - Intergenic
920536222 1:206738208-206738230 CTGTGTCATGCCCAGTGCTTAGG + Intergenic
921345887 1:214184874-214184896 CTGCGTCAGGCACTGTTCTGGGG - Intergenic
922826889 1:228527803-228527825 CTGTGACTGGCTCTGTGCTGGGG - Intergenic
922920236 1:229295731-229295753 CAGTGTCTGTCCCTGTGTTGTGG + Intronic
923259054 1:232249396-232249418 CTGTGGAAGCCCCTGTGTTTGGG - Intergenic
923650691 1:235870317-235870339 CTGTGTCAATCCCTGAGTTTTGG + Intronic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
924300612 1:242633833-242633855 CTCTGTCAGGCACTGTGCTGAGG + Intergenic
924456008 1:244219502-244219524 CAGTGCCAGGCCCAGTGCTGGGG + Intergenic
1063369148 10:5509529-5509551 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1064141984 10:12798322-12798344 ATGTGTCAGGCAGTGTGATGGGG + Intronic
1064265532 10:13822470-13822492 GTGTGTCAGGGACTGTATTGGGG - Intronic
1064658942 10:17586295-17586317 GTGTGTCAGGCCCTGTTGTAGGG - Intergenic
1065720983 10:28628662-28628684 CGGTGTCAGGCCCTGTGCTCAGG - Intergenic
1065843636 10:29726798-29726820 GTTTGCCAGGCCCTGTGCTGAGG - Intronic
1065863887 10:29896447-29896469 ATGTGCTAGGCACTGTGTTGAGG + Intergenic
1066268034 10:33795300-33795322 ATGTGTCAGACCCTGGGCTGGGG - Intergenic
1068000767 10:51331462-51331484 CTGTGGCAGACCCAGTGTTGGGG + Intronic
1068410940 10:56653627-56653649 CTGTGGCAAGCCCAGTGTTGGGG - Intergenic
1068914651 10:62416179-62416201 CTGTGTAAGGACCTGTGCTGAGG - Intronic
1069502033 10:68962356-68962378 CTTTTTCAGGCCCTCTGTGGTGG + Intronic
1069685309 10:70314267-70314289 CTGAGTCAGTTCCTGGGTTGGGG - Intronic
1070299739 10:75194551-75194573 ATGTGTCAGACACTGTGCTGGGG - Intergenic
1070532243 10:77347166-77347188 CTGTATCAGGCTCTGTGCTAGGG - Intronic
1070670912 10:78376621-78376643 CCCTGTCAGGCAGTGTGTTGGGG + Intergenic
1070778551 10:79124447-79124469 CTGTGACAGGCAGTTTGTTGTGG - Intronic
1071195484 10:83153962-83153984 CTGTGGCACGCCCTGTGAGGGGG + Intergenic
1071227953 10:83553539-83553561 CTGAGTCAGTTCCTGGGTTGGGG - Intergenic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1071508480 10:86246795-86246817 CTGGGGGAGGCCCTGTGTAGGGG - Intronic
1071685631 10:87752434-87752456 CTGTGCCAGGCACTATGCTGAGG + Exonic
1072003975 10:91224397-91224419 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1072213010 10:93264115-93264137 CTGTGTCAGGCATTGTGCTATGG - Intergenic
1072531605 10:96324661-96324683 CTGTGTCAGACACAGTGCTGAGG - Intronic
1074272570 10:111969530-111969552 CTGTGTTAGGCACTGAATTGAGG - Intergenic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1074851589 10:117443595-117443617 CTTTGTGGGGCACTGTGTTGAGG + Intergenic
1074974142 10:118566759-118566781 CTGAGTCCTGCCCTGTGGTGGGG + Intergenic
1074987849 10:118673166-118673188 CTGTGCCAGGCCATGTGTTATGG + Intergenic
1075477687 10:122750359-122750381 CTGCTTCAGCCCCTGTGGTGCGG - Intergenic
1076163387 10:128263223-128263245 CTGTGTCATGCCATGTGCTTTGG + Intergenic
1076249469 10:128974002-128974024 CTGTGTCAGCCCTGGTGCTGGGG - Intergenic
1076399642 10:130173196-130173218 CTGAGTCAGGCCCAGTGTGTCGG - Intronic
1076535386 10:131173804-131173826 CTGTGCCAGGTTCTGTGTAGAGG - Intronic
1077011838 11:382265-382287 CTGTGCCGGGCCCTGTGGGGAGG + Intergenic
1077085150 11:746496-746518 CTGAGTCAGTCCCTGGGTAGAGG - Intergenic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1077316308 11:1920856-1920878 CTGTGTCATTGCCTCTGTTGCGG - Intronic
1077388237 11:2285815-2285837 CTGCGTCGGGCAGTGTGTTGGGG + Intergenic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078535595 11:12170890-12170912 CTGTGCCAAGCCCTGTGCTGGGG - Intronic
1078549334 11:12269601-12269623 CTGTGTCTGGCCCAGTGTCCAGG + Intergenic
1078859450 11:15233813-15233835 ATGTCTCAGCCCCTGTGTGGTGG + Intronic
1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG + Intergenic
1079138691 11:17793116-17793138 CTGTGTCAGGCATGGTGCTGGGG - Intronic
1079470050 11:20769537-20769559 CTGTGCCAGGCTCTGTACTGTGG - Intronic
1081665928 11:44917137-44917159 CTCTGTTAGGCACTGTGGTGCGG + Intronic
1081673510 11:44955013-44955035 CTGCCTCAGTCCTTGTGTTGTGG - Intergenic
1082004245 11:47410890-47410912 CTGTGCCAGGCACTGGGCTGAGG + Intronic
1083669098 11:64290702-64290724 GTGTGCCAGGCTCTGTTTTGAGG + Intergenic
1083817981 11:65148120-65148142 CTGTGGCAGGCCCTGGGTCTGGG - Intergenic
1083946206 11:65924552-65924574 CTGAGTCAGGCCCTGGGTGGTGG - Intergenic
1084680528 11:70663794-70663816 CTGTGTCAGCCCTTGTTTGGTGG - Intronic
1084781372 11:71411837-71411859 CTGTTTCAGGTTCTGTGCTGGGG + Intergenic
1085083101 11:73649527-73649549 CTGTGTCCAGCCCGGGGTTGGGG - Intronic
1085152266 11:74261729-74261751 CTGGGTCAGGACCTTTGCTGGGG - Intronic
1085411911 11:76296469-76296491 CTGTGCCCGGCCCAGTGTTGGGG + Intergenic
1085450404 11:76628802-76628824 GTGTGTCAGGCCCTGGGCTGAGG + Intergenic
1085479587 11:76810192-76810214 GTGTGCCAGGCCCTGTGACGGGG - Intergenic
1085634892 11:78151081-78151103 TTGTCTCAGGCCCTGCTTTGGGG - Intergenic
1085637311 11:78168773-78168795 CTGTGAAATGCCCTGTGTTTTGG + Intergenic
1085811504 11:79686706-79686728 CTGTGTCTGGCACTGTTTTAAGG - Intergenic
1085816148 11:79739340-79739362 ATGTGCCAGACCCTGTGCTGGGG - Intergenic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1086162337 11:83735953-83735975 CTGGGTCAGGCCCTGTTTTCTGG - Intronic
1086350379 11:85937867-85937889 CTGTGTCAGCCTCTGGGTGGGGG + Intergenic
1087139951 11:94755635-94755657 CTGTCGCAGGCCCTGTGACGGGG - Intronic
1087971941 11:104494831-104494853 CTGGGTCAGTTCCTGGGTTGGGG - Intergenic
1088432799 11:109777326-109777348 ATGTGTCATGCCCTCTGCTGTGG + Intergenic
1088824604 11:113483233-113483255 CTGTGTCAGGTTCTGTGCTGGGG - Intergenic
1088882774 11:113984510-113984532 CTGTGCCAGGCCCTGTGCTGGGG - Intronic
1090410883 11:126508853-126508875 CTATGACAGGCACTGTGCTGAGG - Intronic
1091056058 11:132420282-132420304 CTGCTCCAGGCCCTGTGTAGGGG + Exonic
1091058688 11:132442077-132442099 TTGTGTCAGACGCTGTGGTGAGG + Intronic
1091195469 11:133727172-133727194 ATATATCAGGCCCTGTGCTGAGG - Intergenic
1091412201 12:250853-250875 CTGCGCCAGGCCCTGTTTTTAGG - Intronic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1092417372 12:8300643-8300665 GTGTGTCAGGCCGTGTGTAGTGG - Intergenic
1092554628 12:9543803-9543825 CTGTGTCAGGCACTGTTATAAGG + Intergenic
1092940498 12:13403140-13403162 TTGAGTCAGGCCCTGTTTAGTGG + Intergenic
1093495567 12:19753075-19753097 CTGAGTCAGTTCCTGGGTTGGGG + Intergenic
1094643948 12:32302948-32302970 CAGAGTGAGGCCCTGTCTTGAGG - Intronic
1095736799 12:45566441-45566463 CTGTGCCAGGCATTGTGTTAAGG + Intergenic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1096333145 12:50732386-50732408 CTGCGTCCGGACCTGTGTGGTGG + Exonic
1096481546 12:51944466-51944488 CTCAGTCAGGCCCTCTGTTTCGG - Intergenic
1098634002 12:72758180-72758202 CCTTGTCAGGCAGTGTGTTGTGG - Intergenic
1100225511 12:92552049-92552071 CTATGTCAGGCCATTAGTTGGGG + Intergenic
1100294592 12:93248918-93248940 CTGAGTCAGTCCCTGGGTGGGGG + Intergenic
1100349652 12:93767502-93767524 GTGTGTCAGGTCCTGTGTTTAGG + Intronic
1101332274 12:103766659-103766681 CTGTGTCAGGCACTGGGCTAGGG - Exonic
1101637076 12:106553132-106553154 CTTTGTAAGTCCCTGTATTGAGG + Intronic
1101886262 12:108665715-108665737 GTGTGTCTGGCTCTGTGCTGAGG - Intronic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1102859753 12:116325559-116325581 GTGTGCCAGGCCCTGTGCTAAGG + Intergenic
1102989078 12:117301946-117301968 CTGTGCCAGGCCCTGTAGAGTGG + Intronic
1103896567 12:124277490-124277512 GTGTGGCAGGTCCTGGGTTGTGG - Intronic
1104337848 12:127917258-127917280 CTGTGTCAGGTGCTGTTTTAAGG - Intergenic
1104858188 12:131911645-131911667 CTCTGGGAGGCCCTGTTTTGGGG - Intronic
1107197305 13:37667942-37667964 CTGTGTCAGGCACTGTCTTCGGG + Intronic
1107326113 13:39244768-39244790 GTGTGCAAGGCCCTGTGTTAGGG - Intergenic
1107404138 13:40097280-40097302 CTGTGTGAGGGCCCCTGTTGAGG - Intergenic
1107834435 13:44402182-44402204 CTGTGCCAGGCCCTGTTTTAAGG + Intergenic
1107984324 13:45762003-45762025 GTGTGCCAAACCCTGTGTTGGGG + Intergenic
1108604202 13:52020969-52020991 ATGTGTCAGGCACTGTTCTGGGG + Intronic
1110979100 13:81873113-81873135 CTGAGTCAGTTCCTGGGTTGGGG - Intergenic
1111625102 13:90774793-90774815 CTGTCTCAGCCCCAGTGTGGAGG - Intergenic
1112260522 13:97873988-97874010 CTGAGTCAGTTCCTGAGTTGGGG + Intergenic
1112433943 13:99377157-99377179 GTGTGTCAGGCTCTGTGTTGGGG + Intronic
1112611729 13:100961918-100961940 ATGTGTCAAACCCTGTGTTAAGG + Intergenic
1112678298 13:101730838-101730860 CTGACTCAGGCTCTGTGGTGAGG + Intronic
1113415588 13:110126054-110126076 CCGTCTCAGGCACTGTGCTGGGG + Intergenic
1113750122 13:112771168-112771190 CTCTGTTAGGGCCTGGGTTGTGG - Intronic
1113846294 13:113393741-113393763 ATGTGTGGGTCCCTGTGTTGTGG - Intergenic
1113922060 13:113918757-113918779 CCGTGTCCAGCCCTGTGATGGGG + Intergenic
1115143135 14:30197022-30197044 ATGTGTCAAGCCCTGTTCTGAGG - Intergenic
1116654022 14:47628384-47628406 CTGTGCCAGGCCTTGAGTTTAGG - Intronic
1119347783 14:73940691-73940713 CTGTGCCAGGCACAGTGTTAAGG - Intronic
1119537439 14:75413934-75413956 GTGTGCCAGGCACTGTGTGGGGG + Intergenic
1119602109 14:75983044-75983066 CAGAGGCAAGCCCTGTGTTGCGG - Intronic
1119616041 14:76099700-76099722 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1120653624 14:87163755-87163777 ATGTGTCAGGACCTGTTTTAGGG + Intergenic
1121059400 14:90891182-90891204 CTGTGCCAGGCCCTGGGGTAGGG - Intronic
1122030849 14:98910636-98910658 CTGTACCAGACCTTGTGTTGGGG - Intergenic
1122813956 14:104303217-104303239 CAGTGTCAGTCCCTGTGTGGGGG - Intergenic
1122886504 14:104712753-104712775 CGGGGTGAGGCCCTGAGTTGCGG - Intronic
1123817075 15:23991049-23991071 TTGTGTCAGTTCCTGTGTGGGGG + Intergenic
1124207532 15:27734490-27734512 CTATGACAGGCCCAGTGCTGGGG - Intergenic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1124988586 15:34648095-34648117 ATGTGCCAGGCACTGTGTTAGGG - Intergenic
1125920557 15:43523050-43523072 CTGTGTGAGGTCCTCTGGTGAGG - Exonic
1125980544 15:43996316-43996338 CTGGGACAGGCCCAGTGTTGAGG + Intronic
1126135197 15:45383076-45383098 CTGTGTCAGGCACTGTGCTAGGG - Intronic
1126529583 15:49698474-49698496 CTGTATTAGGCTCTGTTTTGGGG + Intergenic
1126709946 15:51443996-51444018 CTGGGGCAGGCCTGGTGTTGGGG + Intergenic
1127097688 15:55529180-55529202 CTGTATCAGGCCGTGTGTAGTGG - Intergenic
1127242290 15:57129711-57129733 AAGTGTTAGGCCCTGTGCTGGGG - Intronic
1127907099 15:63383985-63384007 GTGTGTCAGGCACTTTTTTGGGG + Intergenic
1128183681 15:65626122-65626144 CTCTGCCAGGCACTGTGCTGGGG + Intronic
1128687360 15:69696698-69696720 CTGCATCAGGCACTGTGTTTGGG + Intergenic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1130519149 15:84649032-84649054 CTGTGTCAGGCGCAGTGTTTAGG + Intronic
1130837855 15:87669287-87669309 CTGAGTCAGTTCCTGTGTGGGGG - Intergenic
1131249171 15:90819527-90819549 GTGTGACAGGCCCTGTGTGTGGG - Intergenic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132040994 15:98524555-98524577 CTGTCGCTGGCCCTGTGTTCTGG + Intergenic
1132114341 15:99124797-99124819 CAGCCACAGGCCCTGTGTTGGGG + Intronic
1132761728 16:1511801-1511823 ATGTGCCAGGCGCTGTGCTGGGG + Intronic
1132886020 16:2182375-2182397 ATGTGTGTGGCCCTGTGATGTGG - Intronic
1133147536 16:3800997-3801019 CTGTGCCAGGCTCTGTGTTCAGG + Intronic
1133191830 16:4139533-4139555 CTGTATCAGGCCAGGTGTGGTGG + Intergenic
1133970000 16:10560674-10560696 GTGTGATTGGCCCTGTGTTGGGG + Intronic
1134204681 16:12227522-12227544 CTGTGTCAGGCCCTGGGAACTGG + Intronic
1134309306 16:13061163-13061185 CCGTATCAGGCCCCGTGTGGAGG - Intronic
1134504660 16:14795117-14795139 CTGAGTCAGTTCCTGGGTTGGGG + Intronic
1134575913 16:15333792-15333814 CTGAGTCAGTTCCTGGGTTGGGG - Intergenic
1134606246 16:15573514-15573536 CTGAGTCAGTTCCTGGGTTGGGG + Intronic
1134726531 16:16422709-16422731 CTGAGTCAGTTCCTGGGTTGGGG + Intergenic
1134940901 16:18289150-18289172 CTGAGTCAGTTCCTGGGTTGGGG - Intergenic
1135950737 16:26911764-26911786 ATGTGTTAGGCACTGTGTTTGGG - Intergenic
1135955278 16:26951771-26951793 CTGTCTCAGGAGCTGTTTTGGGG - Intergenic
1135971223 16:27073456-27073478 CTGTCTCAGGCCAAGTGTAGTGG + Intergenic
1135992216 16:27224949-27224971 GTGTGTGAGGCTCCGTGTTGGGG - Intergenic
1137308412 16:47229075-47229097 ATGTGTCAGGCACTGTGCTGGGG + Intronic
1137522628 16:49208085-49208107 TTGTGCCAGGCACTGTGCTGAGG + Intergenic
1137606526 16:49790370-49790392 CTGAGCCAGGCACTGTGCTGGGG + Intronic
1137749397 16:50848019-50848041 CTGTGACTGGCCCTATGATGGGG - Intergenic
1138607570 16:58098746-58098768 CTGTGCCAGGCACTGTCCTGGGG + Intergenic
1138771568 16:59670821-59670843 CTGAGTCAGTTCCTGGGTTGGGG + Intergenic
1139066704 16:63324506-63324528 CTGAGTCAGTTCCTGGGTTGGGG - Intergenic
1139391418 16:66608225-66608247 CTGAGCCAGGCCCTGTGGTCAGG - Intronic
1140907181 16:79418855-79418877 TTGTGTGGGGCCCTGTGTTGGGG - Intergenic
1140967502 16:79981166-79981188 CTGCGCCAGGCTCTGTGCTGGGG + Intergenic
1141075824 16:81006363-81006385 TCGTGTCAAACCCTGTGTTGAGG + Intronic
1141269556 16:82526529-82526551 CTGTGCTTGGCCCTGTGCTGAGG + Intergenic
1141331539 16:83115973-83115995 CTGCGTCTGGCCTTGTGTTCAGG + Intronic
1141335715 16:83153267-83153289 CTGAGTCAGTTCCTGAGTTGGGG + Intronic
1141339769 16:83192301-83192323 GTGTGTCAGGGACTGTGCTGTGG + Intronic
1141646510 16:85370699-85370721 CAGTGTCCAGCCCTGGGTTGGGG - Intergenic
1141737373 16:85862527-85862549 CAGTGGCAGGCCCTGTCTTGGGG + Intergenic
1141843619 16:86591646-86591668 ATGTGTCAAGCTCTGTGCTGAGG + Intergenic
1141855710 16:86680124-86680146 CTGTGGCAGGCACTATTTTGGGG - Intergenic
1142179952 16:88663517-88663539 CTGTGTGAGGCGCTGTGCTGGGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1143100884 17:4504084-4504106 CTAAGCCAGGCCCTGTCTTGTGG + Intronic
1143472776 17:7186269-7186291 ATGCGTCAGGCACTGTGCTGAGG + Intergenic
1143974665 17:10821082-10821104 CTGTGCCAGACCCTGTGCTGGGG - Intergenic
1144464249 17:15483958-15483980 CTCTTTCAGACCCTGTGGTGTGG - Intronic
1144771322 17:17761190-17761212 ATGTGCCAGTCCCTGTGCTGAGG - Intronic
1144789457 17:17849374-17849396 GAGTGACAGGCCCTGTGCTGTGG - Intronic
1145753994 17:27376840-27376862 CTGAGTCAGTTCCTGGGTTGGGG - Intergenic
1145913370 17:28555551-28555573 CTGCCTGAGGCTCTGTGTTGAGG - Intronic
1146481529 17:33208770-33208792 ATGTGCCAGGCCCTGTTCTGAGG - Intronic
1146594757 17:34158650-34158672 ATGTGTCAGGACCTGTGTGAGGG + Intronic
1146955445 17:36934419-36934441 AGGTGACAGGCCCTGGGTTGGGG + Intergenic
1147400756 17:40178704-40178726 ATGTGTCAGGCCCTAATTTGGGG - Intronic
1147988065 17:44317912-44317934 CTGTGCCAGGCACCGTGCTGGGG - Intronic
1148147258 17:45373681-45373703 GTGTTTCAGGCCCTGGGCTGGGG + Intergenic
1148750102 17:49940690-49940712 GTGTGCCAGGCACTGTGCTGAGG + Intergenic
1148798294 17:50208049-50208071 CTGCGTCAGGCCCTCTGCTGGGG - Intergenic
1149447607 17:56725711-56725733 CTGTGCCTGGCCCTGTGTTAAGG + Intergenic
1149549753 17:57531694-57531716 GTGTGTCAAGCCCTGTGCTGGGG + Intronic
1150003444 17:61455812-61455834 CTGTGTGAGGGGCTGTGTTTGGG + Intronic
1150227414 17:63531487-63531509 CTGGGGCTGTCCCTGTGTTGGGG + Intronic
1150235473 17:63589456-63589478 GTTTGTCAGGCGTTGTGTTGAGG + Exonic
1151475166 17:74341045-74341067 CTGTGTGAGGCCGGGTGTGGTGG + Intronic
1151902653 17:77027157-77027179 GGGTATCAGGCCCTGTGATGGGG - Intergenic
1151994594 17:77600660-77600682 TTGTCTCAGGCTCTGTTTTGGGG + Intergenic
1152203618 17:78961645-78961667 CTGTGTTAGCACCTTTGTTGGGG - Intergenic
1152335883 17:79700114-79700136 CTGTTCCAGGCCCTCTGCTGGGG - Intergenic
1152782909 17:82234301-82234323 CTGTCCCAGGCACTGTGGTGGGG + Exonic
1152798627 17:82321011-82321033 CTGGGTCAGACCCTGTTCTGTGG - Exonic
1153370041 18:4305094-4305116 ATGTGCCAGGACCTGTGGTGAGG + Intronic
1155095421 18:22550600-22550622 CTGTCCCAGGCACTGTGCTGAGG - Intergenic
1157235192 18:45958903-45958925 CTGAGTCAGTTCCTGGGTTGGGG - Intronic
1158150739 18:54366732-54366754 CTGTGTCTGGCTGTGTGTGGTGG + Intronic
1158243369 18:55403072-55403094 ATGTGTCAGACCCTGGGTTTCGG - Intronic
1158396921 18:57086492-57086514 CTGATTCAGTCCCTCTGTTGGGG + Intergenic
1158791777 18:60788578-60788600 CTGTTTCAGGCTCTATTTTGGGG + Intergenic
1160060622 18:75526033-75526055 ATGTGTCAGGCACTGTGCTGGGG + Intergenic
1160859674 19:1232350-1232372 CAGTGGGAGACCCTGTGTTGTGG - Intronic
1160941865 19:1623885-1623907 CAGTGCCAGGCCCTGTGTCCTGG - Intronic
1161041435 19:2112786-2112808 CTGTGTCCGGCCCCACGTTGGGG + Intronic
1161176228 19:2843822-2843844 CTGAGGCAGCCCCTGTGTTCGGG - Intronic
1161563490 19:4986570-4986592 CTGTGCCAGGCCAGGTGCTGAGG + Intronic
1161612723 19:5251954-5251976 CTATGTCTGTCCCTGTTTTGGGG + Intronic
1162336790 19:10066563-10066585 CTGTTTCAGGCCGGGTGTGGTGG + Intergenic
1162675148 19:12293362-12293384 CTTTTCCAGGCCCTGTGTTATGG - Exonic
1163173827 19:15550954-15550976 GTGTGTCAGGCCCTGAGTTCTGG + Intronic
1163604040 19:18264559-18264581 CTGAGCCAGGCCCTGTGTCAGGG - Exonic
1163644109 19:18478632-18478654 CTGTGTCAGGCCAGCTGTGGCGG - Intronic
1164711338 19:30359250-30359272 CTGTGTCTGCCCCTGTGCTCAGG - Intronic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1164760596 19:30725698-30725720 AGGTGCCAGGCGCTGTGTTGAGG - Intergenic
1165058883 19:33195225-33195247 CTGTTTCCGGCCCGGAGTTGGGG + Intronic
1165842204 19:38795295-38795317 CTGGGTCAGGCCAGGTGCTGTGG + Intergenic
1166127168 19:40722085-40722107 GTGTGCCAGGCCATGTGCTGGGG + Intronic
1166323783 19:42036765-42036787 ATGTGTCAGGCCCTGAGCTGGGG + Intronic
1166389099 19:42399074-42399096 CTGAGTCAGGGCCTGTGCTGGGG - Intergenic
1166561974 19:43738894-43738916 GTGTGCCAGGCCCTGTGCAGGGG - Intronic
1166721087 19:44996336-44996358 CTGTGTTTGGCCCTATGCTGGGG - Intergenic
1166730190 19:45054848-45054870 CTGTGCCAGGCTCGGTGCTGGGG - Intronic
1166752747 19:45172482-45172504 CTGTGCCAGGCCCAGGGGTGTGG + Intronic
1167015713 19:46839691-46839713 CTGTGCCTGGCCCTGTGCTGGGG + Intronic
925293174 2:2761917-2761939 CTGTGTCAGGCACTGTACTAGGG - Intergenic
925443711 2:3909813-3909835 CTGTGCCAGGCCTTGTGATGGGG + Intergenic
925768173 2:7258002-7258024 ATGTGTCTGTTCCTGTGTTGGGG + Intergenic
925976111 2:9143254-9143276 GTGTGCCAGGCCCTGTGCTGGGG + Intergenic
926239300 2:11072733-11072755 CTGAGTCAGTTCCTGGGTTGGGG + Intergenic
926702129 2:15810780-15810802 CTCTGCCGGGCCCTGTGTGGAGG - Intergenic
926889580 2:17627615-17627637 CTGAGTCAGTTCCTGTGTTGGGG + Intronic
927199353 2:20568727-20568749 ATAGGCCAGGCCCTGTGTTGGGG + Intronic
927541991 2:23920540-23920562 CTGTGTCAGGTGCTGTATTCAGG + Intronic
927903810 2:26842990-26843012 CTCAGTAAAGCCCTGTGTTGTGG + Intergenic
928964685 2:36965741-36965763 TTGTGTCAGGCCTTGAGTCGAGG - Intronic
929563001 2:42967570-42967592 ATGTGTCAGGCCCTGGGCAGGGG - Intergenic
931872069 2:66472142-66472164 CTGTGCCAGGCTGTGTGTGGTGG - Intronic
932237559 2:70133041-70133063 CTGTCTGAGGCCCTGTGCTAGGG + Intergenic
934736275 2:96691434-96691456 CTTGGCCAGGCCCTGTGGTGGGG - Intergenic
934854898 2:97723681-97723703 GTGTTTCAGGCCCGGTGCTGGGG - Intronic
934894318 2:98100696-98100718 CTGTGTCAGGCCCTGTATTAGGG + Intronic
935064438 2:99635855-99635877 CTGCCCCAGGCCCTGTGCTGGGG - Intronic
935782365 2:106519435-106519457 CTGAACCAGGCCCTGTATTGAGG + Intergenic
935995188 2:108763679-108763701 CTGTGTCACAACCTGTGGTGAGG - Exonic
936538367 2:113329829-113329851 CTGTGTCAGGCATTGGGTAGTGG + Intergenic
936929415 2:117772070-117772092 CTGTGTGTGGCCCTGTGCTCTGG - Intergenic
937854158 2:126660603-126660625 CTGTGACAGGCCCTGAGTGGGGG - Intronic
938986695 2:136583479-136583501 CTGTGCCAGGCACTGGGCTGTGG + Intergenic
939042612 2:137208739-137208761 CTGAGTCAGCCCCTGGGTAGAGG + Intronic
939462982 2:142521208-142521230 GTGTGTCAGGCACTGTTTTTTGG - Intergenic
941687584 2:168463066-168463088 CTCTGTCAGGCCCTGTAAGGTGG + Intronic
943692391 2:190881527-190881549 CTGTGTGGGGCCCTGCGGTGGGG + Intronic
944678448 2:202053850-202053872 ATGTGCCAGGCTCTGTGCTGGGG - Intergenic
946289617 2:218734369-218734391 GTGTATCAGTCACTGTGTTGGGG + Intronic
946492028 2:220157847-220157869 CTGAGTCAGTTCCTGGGTTGGGG + Intergenic
946691263 2:222310234-222310256 CTGTCTCAGTCTCTGTCTTGGGG + Intergenic
946830116 2:223720132-223720154 CTGTGTCAGTTCCTGGGTGGGGG + Intergenic
948640216 2:239370997-239371019 CTGTGGGAAGCCCTGTGGTGTGG - Intronic
948756798 2:240164815-240164837 CTGTGCCCAGCCCTGTGCTGGGG - Intergenic
948838287 2:240636744-240636766 CTGTGTCCAGCCCTGCGGTGTGG + Intergenic
949025215 2:241764628-241764650 CTGAGGCAGGACCTGAGTTGGGG + Intronic
1168827070 20:821265-821287 CAGTGTCAGGCCCAGAGCTGTGG + Intergenic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1168966853 20:1903969-1903991 GTGTGTCAGGCCCTGTGCTGAGG - Intronic
1168967872 20:1910189-1910211 CTGTGCCAGGCCCTGAGCTAAGG - Intronic
1169077222 20:2768589-2768611 CTCTGTAGGGCTCTGTGTTGTGG - Intergenic
1169664122 20:8015591-8015613 GTGTGTCAGGTTCAGTGTTGGGG - Intronic
1169899699 20:10540319-10540341 CTGTGTCAGGCAATGGGTAGTGG + Intronic
1170098916 20:12677028-12677050 ATGTGTCTGGCTCTGTGTTAAGG + Intergenic
1170291631 20:14776430-14776452 GTGTATCAGGCACTGTATTGAGG - Intronic
1170389159 20:15853254-15853276 CTATGTCAGGCCCTTTGCTGAGG + Intronic
1170907734 20:20530860-20530882 CTCTGCCAGGCGCTGTGCTGAGG - Intronic
1171337164 20:24395037-24395059 CTGTCTCAGGCTCTGCTTTGGGG - Intergenic
1171437947 20:25138117-25138139 GTGTGTCAGGCCCTGTGATAAGG + Intergenic
1171992228 20:31705531-31705553 GTGTGTTAGGCACTGTGCTGGGG - Intronic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1172613152 20:36266505-36266527 CTGTGTCAGGCCCAGGGCTGAGG - Intronic
1172626052 20:36347480-36347502 ATGTGCCAAGCCCTGTGCTGGGG + Intronic
1172699632 20:36845290-36845312 CTGTGTCAGGCCCTGGCATGGGG - Intronic
1173189039 20:40862301-40862323 CAGGGTCAGGCCCCGTGCTGGGG + Intergenic
1175815704 20:61882189-61882211 CTGTGTCTGGCTTTGTGCTGAGG + Intronic
1175828962 20:61951706-61951728 CAGGGTGAGGCCCTGTGGTGGGG + Intergenic
1176408721 21:6436279-6436301 CTGGGTCAGCCCCTGGGTCGGGG - Intergenic
1178461587 21:32807217-32807239 ATGTGCCAGGCCCTGTGCTAAGG - Intronic
1179982203 21:44901419-44901441 CTCTGTCAGGCGCTGTGTGGGGG - Intronic
1180011595 21:45054935-45054957 CTGTGTCAGCCGGTGTGTCGAGG - Intergenic
1180077595 21:45470902-45470924 CTGGGTCTGGCCCTGGGCTGGGG + Intronic
1180730054 22:17974422-17974444 CTGTGTGAGGCCAGGTGTGGTGG + Intronic
1181361979 22:22344551-22344573 CTGTCCCAGGCCCTGCCTTGGGG + Intergenic
1181541960 22:23578432-23578454 CAGGGTCAGGCTCTGTGCTGGGG - Intronic
1181905366 22:26190698-26190720 CTCTTTCAGTCCATGTGTTGGGG - Intronic
1182007961 22:26977227-26977249 CTGTGCCAGGCACTGTGATAAGG - Intergenic
1182025352 22:27114023-27114045 ATGTGCCAGGCCCTGTGTTAGGG + Intergenic
1182434117 22:30319387-30319409 CTCTGTCAGACCCTGTGATTTGG - Intronic
1182645761 22:31808133-31808155 CTCTGTCATGCCCAGTGTAGTGG + Intronic
1182743106 22:32583164-32583186 GTGTGTCTGTCCATGTGTTGGGG - Intronic
1182924928 22:34113349-34113371 GTGTGTCAAGCACTGTGTTAGGG + Intergenic
1183056228 22:35307754-35307776 CTGTCTCAGCCCCTGTGGTCTGG - Intronic
1183247962 22:36708606-36708628 CTGTGTCAGGCCCTGTGCTGAGG + Intergenic
1183587216 22:38759818-38759840 CTATGTCAGCCCCTGAGTTCTGG - Intronic
1183769075 22:39907950-39907972 CTGTGTTTGGACCAGTGTTGTGG - Intronic
1184107696 22:42377906-42377928 ATGTGTCAAGCCCAGTGCTGTGG - Intergenic
1184112468 22:42403384-42403406 ATGTGTCAGGCCCTGTACAGAGG - Intronic
1184507796 22:44914607-44914629 GTGTCTCAGGCACTGTGGTGTGG - Intronic
1184612694 22:45615137-45615159 CTGTCTCAGGCCCAGTGTGGTGG - Intergenic
1185004510 22:48267853-48267875 CTATGTCAGCGTCTGTGTTGCGG + Intergenic
1185010123 22:48308247-48308269 CTGTGCCAGGCCCTGGGTGAAGG + Intergenic
1185344230 22:50304419-50304441 CTGTGTCAGGGCCTGGCTTGAGG + Intronic
1203326251 22_KI270738v1_random:23593-23615 CTGTGTGATGCCCTATCTTGGGG - Intergenic
949592531 3:5509274-5509296 ATGTGTTAGACCTTGTGTTGGGG - Intergenic
950151574 3:10691586-10691608 CTTTGTCAGGCCCAGAGTCGGGG - Intronic
950716166 3:14849151-14849173 CTCTGTCTGGCCCTGTGTGATGG + Intronic
951188009 3:19736307-19736329 CTATTCCAGGCCCTGTGCTGAGG - Intergenic
951582763 3:24183289-24183311 AAGTGTCAGGCACTATGTTGGGG + Intronic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
953141981 3:40237564-40237586 CTGTGTCAGGCTCTGGGTGGTGG - Intronic
953203874 3:40803304-40803326 CTGGGTCAGCTCCAGTGTTGGGG + Intergenic
953295485 3:41711240-41711262 TTGTGTCACCCCCTGTGTTGTGG - Intronic
953481502 3:43256125-43256147 CTGTGCCAGGCACTGTGAGGGGG + Intergenic
953698403 3:45177821-45177843 ATGGGTCAGGCACTGTTTTGAGG - Intergenic
954037488 3:47859432-47859454 CTGTGCCAGGCCTTGGGCTGTGG - Intronic
954290949 3:49649781-49649803 CTGTTTCAGGCCCAGTGCTGGGG - Intronic
954576163 3:51677529-51677551 CTGTGTCAGGCTCTGTGAGTGGG + Intronic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
954915036 3:54141471-54141493 CTTTCTCAGGTCCTGTTTTGTGG + Intronic
955194877 3:56795921-56795943 CTGTGTCATGCCCAGTGTGGTGG - Intronic
955338338 3:58105276-58105298 CTGTGTCAGGCTGGATGTTGGGG + Intronic
955994563 3:64666703-64666725 CTGTGTCATGCCCTGCTTTAAGG - Intronic
956354221 3:68373106-68373128 ATGTGCCAGGCACTGTGTTAGGG - Intronic
956582872 3:70833592-70833614 CTCTTTGAGGCACTGTGTTGTGG + Intergenic
957728957 3:84107091-84107113 CTTTGGGAGGCCCTGTCTTGTGG + Intergenic
957983755 3:87546154-87546176 CTGAGTCAGTTCCTGGGTTGGGG - Intergenic
958950262 3:100408712-100408734 CTGTGACAGGCCTGGTATTGGGG + Intronic
959069707 3:101690841-101690863 CTCAGTCAGGCCGTGTGTGGTGG + Intergenic
960617031 3:119605515-119605537 TTGTGTGAGCCCCTTTGTTGAGG - Intronic
961110322 3:124278092-124278114 GTGTGACAGGCCTTCTGTTGGGG + Intronic
961115217 3:124323456-124323478 GTGGGCCAGGCTCTGTGTTGGGG - Intronic
961475907 3:127146213-127146235 GTGTGCCAGGCCCTATGTTATGG - Intergenic
961519927 3:127461202-127461224 CTGTGCTAGGCCCTGTGCTGGGG + Intergenic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961744138 3:129052975-129052997 CTTTTTCAGGCCCTGGGGTGGGG + Intergenic
961907521 3:130277702-130277724 AAGTGTCAGGCCCTGTCCTGGGG - Intergenic
962050701 3:131811781-131811803 TTGTGTCAGGCACTGTGTTAAGG + Intronic
962239849 3:133743231-133743253 ATGTGTCAGGCACTGTCCTGGGG - Intergenic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
962742568 3:138372623-138372645 ATGTGCCAGGCCTGGTGTTGAGG - Intronic
962924081 3:139975830-139975852 TTGTGGCAGCTCCTGTGTTGTGG - Intronic
963460735 3:145611492-145611514 CTGTGGCTGGCCCAGTGTTGAGG + Intergenic
965754902 3:172015813-172015835 CCGTGTCAAGCACTGTGCTGGGG - Intergenic
966775199 3:183537579-183537601 CTGGGTCAGGCTCTATTTTGGGG - Intronic
967070819 3:185961039-185961061 CTGTGGCACACCCTGTGGTGGGG - Intergenic
967229130 3:187320919-187320941 CTGGGTCAGGCTCTGTGTCTGGG + Intergenic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
967888784 3:194350573-194350595 ATGTGCCAGGCGCTGTGTTAAGG - Intronic
968495527 4:913365-913387 CTGTGGCAGGGGCTGTGCTGGGG - Intronic
968501149 4:950663-950685 CTGTCCCAGGCCCTGGGTTTGGG - Intronic
968976633 4:3825488-3825510 ATGTGGCAGGCCCTGTTTTAGGG - Intergenic
969482228 4:7452882-7452904 TGGGGTCAGGCGCTGTGTTGGGG + Intronic
969482287 4:7453166-7453188 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482296 4:7453202-7453224 TGGGGTCAGGCGCTGTGTTGGGG + Intronic
969482308 4:7453258-7453280 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482320 4:7453316-7453338 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482332 4:7453372-7453394 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482363 4:7453520-7453542 TAGGGTCAGGCACTGTGTTGGGG + Intronic
969482374 4:7453576-7453598 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482386 4:7453632-7453654 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482397 4:7453688-7453710 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482401 4:7453706-7453728 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482445 4:7453918-7453940 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482485 4:7454110-7454132 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482497 4:7454168-7454190 TGGGGTCAGGCGCTGTGTTGGGG + Intronic
969482513 4:7454246-7454268 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482522 4:7454282-7454304 TGGGGTCAGGCGCTGTGTTGGGG + Intronic
969482534 4:7454338-7454360 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482572 4:7454542-7454564 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482592 4:7454638-7454660 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482596 4:7454656-7454678 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482617 4:7454748-7454770 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482628 4:7454803-7454825 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482648 4:7454897-7454919 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482683 4:7455083-7455105 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482701 4:7455179-7455201 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482705 4:7455197-7455219 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482714 4:7455233-7455255 TGGGGTCAGGCGCTGTGTTGGGG + Intronic
969482726 4:7455291-7455313 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482730 4:7455309-7455331 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482751 4:7455401-7455423 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482781 4:7455548-7455570 TAGGGTCAGGCACTGTGTTGGGG + Intronic
969482793 4:7455606-7455628 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482835 4:7455804-7455826 TAGGGTCAGGCTCTGTGTTGGGG + Intronic
969550332 4:7862043-7862065 CTGTTTCAGGCCGAGTGTGGTGG + Intronic
970035617 4:11732277-11732299 CTGTGCCAGGCCCTCGGTTAGGG + Intergenic
970421702 4:15911067-15911089 CTGTGTCAGGTGCTGTGTTCAGG + Intergenic
972629138 4:40828521-40828543 CTGTGCCAGGCCATGTTCTGAGG + Intronic
973796739 4:54434839-54434861 AGGTGTAAGGCTCTGTGTTGAGG - Intergenic
974104479 4:57454067-57454089 TTGTGGCAGGCCCAATGTTGGGG + Intergenic
975825447 4:78315015-78315037 CTGTGTCAGGTCTTGTGCCGGGG - Intronic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
976669140 4:87632704-87632726 CTGTGTTAGGCATTGTGGTGGGG - Intergenic
977096695 4:92754591-92754613 CTGTGTCAGGCGCTGATTTAAGG - Intronic
977509961 4:97951073-97951095 CTGAGTCAGTCCCTGGGTGGGGG - Intronic
977640510 4:99353320-99353342 CTGTGTCAGGCACTAAGCTGGGG + Intergenic
978289433 4:107119553-107119575 CTGTGTTAGGCTCTGTGTGTAGG + Intronic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
982110209 4:152046391-152046413 CTGTGTCAGGCTCAGTATTTGGG - Intergenic
984520465 4:180795972-180795994 CTGTCTCACGTCCTGTGATGGGG - Intergenic
984922595 4:184778685-184778707 ATATGTCAGACACTGTGTTGGGG - Intronic
985352874 4:189084901-189084923 CTGTCACATGTCCTGTGTTGCGG + Intergenic
986334842 5:6746482-6746504 TGGTGACAGGGCCTGTGTTGGGG + Intronic
986352780 5:6895775-6895797 CTTTGTCAGCCCCTGTGCTGGGG - Intergenic
988419836 5:30992081-30992103 CTGAGTCAGTTCCTGGGTTGGGG - Intergenic
988688789 5:33550830-33550852 CTGTGTCTGTCCCTGTGCTAGGG - Intronic
990086049 5:51979119-51979141 ATGTGTCAGGCACTATGATGAGG - Intergenic
990203160 5:53400234-53400256 CTGTCTCAGGCCTTGTGTCTGGG - Intergenic
990236230 5:53771367-53771389 CTGGATCAGGCCCAGTGTTGGGG - Intergenic
991496631 5:67233189-67233211 CTGAGTCAGTTCCTGTGTGGGGG - Intergenic
991599671 5:68340080-68340102 ATGTGTCAGCCTCTGTGTTGGGG - Intergenic
991639517 5:68738943-68738965 ATGTGTCTGGCACTGTGATGGGG - Intergenic
992006013 5:72478208-72478230 CTGTGCCAGGCCTTGTGTGGGGG + Intronic
993109844 5:83643488-83643510 CCGTGTGGGGCCCTGTGTGGTGG - Intronic
993371608 5:87099470-87099492 CTGTGTCAGTGTGTGTGTTGAGG - Intergenic
993822342 5:92634004-92634026 ATGTTTCAGTCACTGTGTTGTGG - Intergenic
994505196 5:100634292-100634314 CTGTGTCAGCCACTGTGCTAAGG + Intergenic
998145242 5:139724140-139724162 CTGTCTGAAGCACTGTGTTGAGG - Intergenic
998216431 5:140241398-140241420 AAGTGCCAGGCCCTGTGCTGAGG - Intronic
998356447 5:141540770-141540792 CCATTTCAGGCCCTGTGTGGTGG + Intronic
999862534 5:155663877-155663899 CTGTATCAGGCACTGTTGTGAGG - Intergenic
1000261590 5:159593657-159593679 CTGAGTCAGTCCCTGGGTGGGGG - Intergenic
1002284398 5:178152761-178152783 CTTTTTCAGGCACTGTGTTATGG - Intronic
1002685475 5:181005900-181005922 CTGTGTCTGGGTCTGTGGTGTGG - Exonic
1003050093 6:2772431-2772453 GTGTGCCAGGCACTGTGCTGGGG - Intronic
1003316449 6:5016914-5016936 CAGAGTGAGACCCTGTGTTGGGG - Intergenic
1004075469 6:12340447-12340469 CTGGGTCTGGCCCTGGGTTCTGG + Intergenic
1004362772 6:14985894-14985916 CTGTGCCAGACCCTGCGCTGGGG + Intergenic
1004380693 6:15129789-15129811 CAGTGTTAGGCCCTGTGCTAGGG - Intergenic
1004426337 6:15509697-15509719 CTGTGGCATGGCCTGTGTTCTGG + Intronic
1005873405 6:29994289-29994311 CTATTTCCGGCCCTTTGTTGGGG + Intergenic
1005957492 6:30674420-30674442 CTGTCTCAGGCCCAGTGCGGTGG - Intergenic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1006466504 6:34197732-34197754 TTGTGCCAGGCCCTCTGCTGGGG + Intergenic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1007481232 6:42151456-42151478 CTGTGTCAGGCTCTGTGCTCAGG + Intergenic
1007627967 6:43257190-43257212 CTCTGCCAGGCCCTGGGTTCAGG - Intronic
1007709036 6:43810055-43810077 CTGGATCAGGCACTGTGTTTAGG - Intergenic
1008424650 6:51343130-51343152 GTGTGTCAGGCACTGGGTTAGGG - Intergenic
1009425269 6:63506883-63506905 TTGTCTCAGGCTCTGTTTTGAGG - Intergenic
1011335105 6:86251539-86251561 ATGAGCCAGGCCCTGTGTTGGGG + Intergenic
1011749347 6:90439582-90439604 CTGTGTCAGGCACTGCATTAGGG - Intergenic
1012814713 6:104008615-104008637 CTGTGCTAGACCCTGTGCTGTGG - Intergenic
1013015962 6:106160844-106160866 CTGTGCCAGGACATGTCTTGTGG + Intergenic
1013033408 6:106358253-106358275 ATGTGCCAGGCCCTGACTTGGGG - Intergenic
1013089625 6:106888397-106888419 CTGAGTCAGTTCCTGGGTTGGGG - Intergenic
1014432960 6:121390767-121390789 CTGTGTGCAGGCCTGTGTTGGGG - Intergenic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1016808438 6:148236497-148236519 CTGTGTGAGGCCGGGTGTGGTGG - Intergenic
1017892129 6:158647417-158647439 TTGTGTCAGGCTCTGAGCTGGGG + Intergenic
1018788550 6:167128248-167128270 CTGTGTCAGGGCCTGGGCAGGGG + Intronic
1019271638 7:152500-152522 GTGTGTCAGGACCTGTCTCGGGG - Intergenic
1019423508 7:962688-962710 CTGTGTGAGGCCCTGAGTTTGGG + Intronic
1019599126 7:1872716-1872738 CCGTGTCTGGCCCTGTGCTGGGG - Intronic
1019701307 7:2476112-2476134 CTATGTCTGGCACTGGGTTGGGG - Intronic
1022472386 7:30689671-30689693 GTGTGTCAGGCCCTGGCTGGGGG + Intronic
1022812381 7:33882612-33882634 CTATTTCAAGCCCTGTTTTGAGG + Intergenic
1024502907 7:50131824-50131846 CTGTGTCATGCCATGTGTTTTGG - Intronic
1026256744 7:68718795-68718817 ATGTGCCAGGCCCTATGTTGAGG - Intergenic
1027429574 7:78096404-78096426 ATGTGTCAGGCACTGTGCTAAGG - Intronic
1029104761 7:98166003-98166025 CAGTGCCCGGCCCTGTGCTGGGG + Intronic
1029380441 7:100210964-100210986 CTGTCGCAGGCCCTGGGCTGTGG + Intronic
1029559652 7:101294150-101294172 CTGAGTCAGTCCCTGGGTGGGGG + Intergenic
1030653058 7:112136505-112136527 ATGTGTCAAGCCCTTTGCTGGGG + Intronic
1030764402 7:113390955-113390977 CTGTGTCAGGCACTGGGTAGAGG + Intergenic
1031011335 7:116527102-116527124 TTGTGTCAGGTCTTGTGCTGAGG + Intronic
1032411455 7:131696067-131696089 CTGTGTCAGGCTCTGTTTTGGGG + Intergenic
1034545125 7:151784474-151784496 CTGGGTCAGGGCCTCTGTTAAGG - Intronic
1034633735 7:152550921-152550943 CTGCTTCAGGCCCGGTGCTGTGG + Intergenic
1035626761 8:1076725-1076747 TGGTGTGAGGCCCTGTGTTATGG - Intergenic
1036200079 8:6763479-6763501 CTGTGTTAGGCGCTGTGCTAGGG + Intergenic
1036635810 8:10548836-10548858 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1037487608 8:19363365-19363387 CTGTGCCCGGCCTTATGTTGGGG + Intronic
1037506869 8:19539452-19539474 ATATGCCAGGCCCTGTGCTGAGG - Intronic
1037864610 8:22433273-22433295 GTGTGCCAGGCACTGTGTTAAGG - Intronic
1038211297 8:25521348-25521370 CTGGCACAGGTCCTGTGTTGGGG + Intergenic
1038970979 8:32635219-32635241 CTGTGACAGGCATTGTGCTGGGG - Intronic
1039061083 8:33572712-33572734 CTGTGCCAAGCCCTGTGCTCAGG + Intergenic
1039557322 8:38485806-38485828 CAGTGGCAGGGGCTGTGTTGTGG - Intergenic
1039785596 8:40831890-40831912 CTGAGCCAGGCCTTGTGCTGAGG + Intronic
1039969166 8:42306957-42306979 CTGTGTCAGGCACTGTGCTCAGG + Intronic
1041361732 8:57061828-57061850 GTGTGCCAGGCACTGTGTTAAGG - Intergenic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1041758028 8:61335055-61335077 CTGAGTCAGTTCCTGGGTTGGGG + Intronic
1041870009 8:62622734-62622756 CTGTGACAGGCCCTGTTAAGAGG - Intronic
1041890898 8:62867374-62867396 CTGTGCTAGGCACTATGTTGAGG - Intronic
1042769786 8:72367121-72367143 CTTTATCAGACCCTGTGTGGTGG + Intergenic
1043307714 8:78817898-78817920 CTGTGGTGGGCCCAGTGTTGGGG + Intergenic
1045690847 8:104758379-104758401 CTGAGTCAGTTCCTGAGTTGGGG + Intronic
1046126517 8:109915955-109915977 CTGTGCCAGGCTCTTTTTTGTGG - Intergenic
1047756170 8:127919969-127919991 GTGTGTCAGGCCAAGTGTTTTGG - Intergenic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1048204647 8:132405568-132405590 CAGTGTCAGGGGCTGTGCTGGGG + Intronic
1048611984 8:136033101-136033123 CTGTGTGAGGCCCTGAGCAGTGG + Intergenic
1048934222 8:139341891-139341913 CTGTGTCCTGCCCTGTGTCCTGG - Intergenic
1048959458 8:139563756-139563778 CTGAGTCAGGCCCTGTCCTCTGG + Intergenic
1049093419 8:140534054-140534076 CTGTGTCTAGCCCTGTGCCGAGG + Intronic
1049093688 8:140535300-140535322 CTGTGCCAGGCGCTGGGGTGGGG - Intronic
1049261427 8:141641261-141641283 CTATGTCAGGCTCTGTGCTCTGG - Intergenic
1049746678 8:144266045-144266067 CTGTGCCAGGCCGTGTGCAGGGG - Intronic
1050566564 9:6890098-6890120 TCATGACAGGCCCTGTGTTGAGG - Intronic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1052234025 9:26188736-26188758 ATGTGGCAGGCCCAGTGCTGGGG - Intergenic
1052447020 9:28575961-28575983 CTATGTCTGTCCCTGTGTGGGGG - Intronic
1052750836 9:32488335-32488357 ATGTGTCAGGCTCTGTGCTAAGG - Intronic
1055083775 9:72293334-72293356 CTGTGTCAGGCACTGGGTTTAGG + Intergenic
1055307881 9:74949871-74949893 CACTGTCAGGCCCTCTTTTGAGG - Intronic
1056991743 9:91419673-91419695 ATGTGCCAGGCACAGTGTTGAGG - Intronic
1057441851 9:95089162-95089184 CTCTGCCAGGCCCTGGGTGGAGG - Intergenic
1057847652 9:98537988-98538010 CTGTGATGGGCCCTGTGCTGTGG - Intronic
1058835070 9:108853464-108853486 GTGGGTCAGGCCCAGTGCTGGGG - Intergenic
1059341905 9:113602120-113602142 CTGTGCCTGGCCTTGTGCTGAGG - Intergenic
1059664753 9:116436106-116436128 ATGTGTCAGGCCGTGTGCTGGGG - Intronic
1060264110 9:122100344-122100366 CTGTGCTGGGCCCTGTGCTGGGG - Intergenic
1060290052 9:122293727-122293749 ATGTGCCAGGCTCTGTGCTGGGG + Intronic
1060390507 9:123272682-123272704 ATGTATCAGGCCCTGTGCAGAGG - Intergenic
1060824416 9:126679814-126679836 CAGAGTCAGGCTCTGTGTAGAGG - Intronic
1061017947 9:127993516-127993538 ATGTGCCAGGCCCTGGGTTGGGG - Intergenic
1061087417 9:128407205-128407227 CTGGGTCAGGCTCTGTTCTGAGG + Intergenic
1061192095 9:129087970-129087992 CTGTGCCAGGCTGTGTGCTGGGG + Intronic
1061203275 9:129149212-129149234 ATGTGCCAGGCCCTGAGCTGAGG - Intergenic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061282126 9:129603390-129603412 CTATTTCAGGCACTGTGCTGTGG - Intergenic
1061389859 9:130311443-130311465 GTGTGCCAGGCCCTGTGCTGGGG + Intronic
1061527382 9:131177890-131177912 ATGTGCCAGGCTCTGTGTTAGGG - Intronic
1061627635 9:131850723-131850745 CATTGTAAGGCCCTGTGCTGAGG + Intergenic
1062081040 9:134623573-134623595 CTATGACAGGTCCTGTGTTCCGG + Intergenic
1062105648 9:134753438-134753460 CTGAGTCAGGCCCTGTGTGGAGG - Intronic
1062289940 9:135789947-135789969 CAGTGCCAGGGCCTGGGTTGTGG - Intronic
1185971881 X:4674193-4674215 CTGTGTCAGTTCCTGCGTGGGGG + Intergenic
1186405021 X:9294304-9294326 CTGTGTCCAGCCCGGTGTAGGGG - Intergenic
1186692268 X:11990815-11990837 CTCTGTAAAGCCCTGTGTAGAGG - Intergenic
1186874468 X:13803421-13803443 CTGTGACAGTCCCTATGTAGAGG + Intronic
1187043817 X:15625672-15625694 CTTTAGCAGGCCCTGTGTTAAGG + Intergenic
1187376337 X:18758554-18758576 CTGAGTCAGGGCATGTGATGAGG - Intronic
1189011094 X:37046322-37046344 CTGTGTGAGGCCCAGGGTTCAGG + Intergenic
1189035307 X:37489223-37489245 CTGTGTGAGGCCCAGGGTTAAGG - Intronic
1189085699 X:38021303-38021325 GCTTGTCAGGCCCTGTGGTGAGG + Intronic
1190281903 X:48936682-48936704 CTGTATCGGGCCCTGAGCTGGGG - Intronic
1190338780 X:49279989-49280011 GTGTGTCAGGCCCTGATTTCTGG + Intronic
1190571612 X:51788333-51788355 GGGTGTCAGGCACTGTGATGAGG - Intergenic
1190897757 X:54638347-54638369 CTGTATCAGGCACTGTGTGAAGG - Intergenic
1191681561 X:63846007-63846029 GTGTGTCAGGCACTGTTTTAAGG + Intergenic
1191845860 X:65547517-65547539 CCCTTTCAGGCCCTTTGTTGAGG + Intergenic
1192054940 X:67763804-67763826 CTGTGCCAGGCCCTGTTTCAGGG + Intergenic
1194934452 X:99931466-99931488 CTGTGCCAGGCACTATGTTAAGG + Intergenic
1195555356 X:106215281-106215303 TTGTATCAGGCTCTGTTTTGTGG + Intergenic
1196126688 X:112108947-112108969 CTGTGGCAGGCCCAGTATTGAGG + Intergenic
1197377596 X:125700798-125700820 CTTTGTCAATGCCTGTGTTGAGG + Intergenic
1197652577 X:129081937-129081959 CTGAGTCAGCCTCTGGGTTGAGG + Intergenic
1198675405 X:139125689-139125711 CAGTGCCTGGCCCTGTGTTAGGG + Intronic
1199681729 X:150229411-150229433 CTGTGCCAAGCCCTGTGCTGAGG - Intergenic
1200067276 X:153509900-153509922 CTGTGTCACCCCCTGGGTTTTGG - Intergenic
1200164542 X:154027092-154027114 CTGTGTCCGGCCCAGTTTTGGGG - Intronic
1200329596 X:155282441-155282463 CTGTGTTGGGCCCAGTGTTTGGG - Intronic
1200872737 Y:8121126-8121148 CTGTGACAGGGGCTGTGGTGGGG + Intergenic
1201694304 Y:16807927-16807949 CTGAGTCAGTCCCTGGGTGGGGG - Intergenic