ID: 954702260

View in Genome Browser
Species Human (GRCh38)
Location 3:52456421-52456443
Sequence CATAGCTTAGAAGTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 174}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954702260_954702269 21 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG 0: 1
1: 0
2: 0
3: 2
4: 17
954702260_954702266 -10 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702266 3:52456434-52456456 CTAAGCTATGGGGGAGACAGAGG 0: 1
1: 0
2: 2
3: 23
4: 510
954702260_954702271 23 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702271 3:52456467-52456489 GGTAGTTCCCGACTTTGACGGGG 0: 1
1: 0
2: 0
3: 0
4: 19
954702260_954702270 22 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702270 3:52456466-52456488 GGGTAGTTCCCGACTTTGACGGG 0: 1
1: 0
2: 0
3: 1
4: 31
954702260_954702272 27 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702272 3:52456471-52456493 GTTCCCGACTTTGACGGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 34
954702260_954702267 1 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702267 3:52456445-52456467 GGGAGACAGAGGACAAATAGCGG 0: 1
1: 0
2: 3
3: 41
4: 431
954702260_954702268 2 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702268 3:52456446-52456468 GGAGACAGAGGACAAATAGCGGG 0: 1
1: 0
2: 0
3: 31
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954702260 Original CRISPR CATAGCTTAGAAGTGTGTGT GGG (reversed) Intronic
902706216 1:18206943-18206965 TGTAGCTTAGAAGTCTGAGTAGG + Intronic
906555381 1:46707461-46707483 AATAGCTTAGGAGTGGGTGATGG - Intronic
907383854 1:54112863-54112885 CTGAGCTGAGAAGTGTGTGCTGG + Intergenic
907965376 1:59323793-59323815 CATTGCCTAGAAATGTGTATGGG + Intronic
909702854 1:78546928-78546950 CAGAGCTTAGAATTATGTGGTGG + Intergenic
912803156 1:112734285-112734307 CATAGGTTAGAAGTGTCAGCAGG + Intergenic
913453187 1:119006784-119006806 CAGAGCTGCGAGGTGTGTGTTGG - Intergenic
915694246 1:157722787-157722809 CAGAGGTTAGAAGAGTGTGGAGG - Intergenic
916281973 1:163061636-163061658 AAGAGGTTAGAAGAGTGTGTAGG - Intergenic
917204928 1:172562007-172562029 TATTGCTTAGAAGTGTTTGGGGG - Intronic
917496236 1:175542575-175542597 CATTGCTTGGAGGTGTGGGTGGG - Intronic
919339450 1:196285094-196285116 CATAGCTAAGAGGTTTGTGGAGG - Intronic
919983883 1:202659487-202659509 GATAGCTTAGAAGTGTGGTCAGG + Intronic
920024574 1:202984477-202984499 CATAACTTAGCCGTGTGTGGTGG - Intergenic
922629065 1:227085461-227085483 AATAGCTTAGAATTGAGAGTTGG - Intronic
922971141 1:229739915-229739937 CACATTTTAGAATTGTGTGTGGG - Intergenic
923570454 1:235108503-235108525 GAAAGCTTATAAGTTTGTGTTGG - Intergenic
924155793 1:241175312-241175334 CAAAGCTTAGAAGTCAGTGGTGG + Intronic
1066567004 10:36731321-36731343 CATAGCAGAGAATTATGTGTTGG - Intergenic
1069477122 10:68744575-68744597 TATAGCTTTGTAGTGTTTGTAGG + Intronic
1069966513 10:72122452-72122474 TGTTGGTTAGAAGTGTGTGTTGG - Intronic
1070367852 10:75753491-75753513 AGAAGCTCAGAAGTGTGTGTGGG + Intronic
1070368824 10:75762316-75762338 CAAAGTTTACAAATGTGTGTTGG - Intronic
1072747004 10:97947507-97947529 GACAACATAGAAGTGTGTGTTGG + Intronic
1077307898 11:1876089-1876111 TACAGCTTCGGAGTGTGTGTCGG - Intronic
1079023392 11:16926380-16926402 AATGAATTAGAAGTGTGTGTGGG - Intronic
1079485683 11:20933894-20933916 CATAATGGAGAAGTGTGTGTTGG + Intronic
1079737827 11:24019241-24019263 CATTGCTTAGAAGTGAATGACGG + Intergenic
1083459958 11:62804756-62804778 CATTTCTTAAGAGTGTGTGTGGG - Intronic
1083988628 11:66233123-66233145 CATTGCTTAGAAGTCAGGGTTGG - Intronic
1085325750 11:75605462-75605484 CAGTGCTTGGAAGTGTCTGTGGG - Intronic
1085922607 11:80976720-80976742 TATAGCTTGGACGTGTGTGATGG + Intergenic
1087232814 11:95685023-95685045 CACAGCTTAGCAGTCTGTGGGGG + Intergenic
1088348672 11:108860240-108860262 CATAGCTTAAAAGTATGTAAAGG + Intronic
1093929658 12:24942770-24942792 ACTAGTTTGGAAGTGTGTGTGGG - Intronic
1096098347 12:48952781-48952803 CCTAGAGTAGAAGTGTGTTTGGG - Intronic
1098805626 12:75017211-75017233 CAAAGCTTAGAATTGAGTCTGGG + Intergenic
1100645425 12:96524633-96524655 CATAGCTTAGAAGCCAGAGTAGG + Intronic
1104383014 12:128324474-128324496 CATAGCATAGATGTGTGTATAGG + Intronic
1112732796 13:102385326-102385348 GATAACTTAGAAGTAAGTGTTGG - Intronic
1113899261 13:113787660-113787682 CATGGCTTAGAACTGTGAGCAGG + Intronic
1113961622 13:114129514-114129536 AATAGCTTTGAAATGTGTGGTGG - Intronic
1114339444 14:21727695-21727717 CAGATCTTAAAAGTGTGTTTGGG + Intergenic
1117557685 14:56902711-56902733 CATAGCTTAGAAGAGTTTCAGGG - Intergenic
1117990315 14:61426275-61426297 GACAGCTTGGCAGTGTGTGTAGG - Intronic
1118864737 14:69694123-69694145 TATGGCTTAGATGTGTGGGTTGG + Intronic
1119454000 14:74738307-74738329 CATAGCTTAGAAATAAGTTTAGG - Exonic
1120569769 14:86102486-86102508 CATATCTTAAATGTGTGTTTTGG - Intergenic
1120707870 14:87763029-87763051 CAAAGGTTAGAAGAGTGTGGAGG - Intergenic
1126433944 15:48616958-48616980 CATAGCTTAGACGTGTCTAATGG + Intronic
1126547474 15:49888938-49888960 CATAGCTTAGAGCTGTGGGAGGG - Intronic
1126685436 15:51245039-51245061 CATAGGTTATAAGTGTGTAGGGG - Intronic
1127558759 15:60114868-60114890 CATAGGTGGGAGGTGTGTGTGGG + Intergenic
1128134964 15:65256040-65256062 TATACCTGAGAAGTGTCTGTTGG - Intronic
1131695122 15:94868510-94868532 CATGGTTTAAAAGTGTGTGGTGG - Intergenic
1132237662 15:100234192-100234214 GATGGATTAGAAGTGTGTATCGG + Intronic
1133901435 16:9978920-9978942 AATGTCTTAGAAGTGTCTGTGGG - Intronic
1148720377 17:49748355-49748377 TGAAGCTTAGAGGTGTGTGTTGG - Intronic
1148778502 17:50109117-50109139 CTGAGGTAAGAAGTGTGTGTGGG - Intronic
1149284659 17:55149138-55149160 CATAGCTAAGAAGTATTTGGGGG - Intronic
1149781963 17:59404914-59404936 CAGAGCTTAGAACTGTGGGATGG + Intergenic
1150471604 17:65442309-65442331 CATAGTTTAGAAGTGAGTTCAGG + Intergenic
1152791980 17:82285244-82285266 AATAGATTAAAAGTGTGTGTTGG + Intergenic
1157903315 18:51542026-51542048 GGGAGCTTAGAAGTGTGTGGTGG - Intergenic
1160504818 18:79421112-79421134 TCCAGCGTAGAAGTGTGTGTGGG - Intronic
1162936862 19:13985851-13985873 CAGAGCGCAGGAGTGTGTGTTGG + Intronic
1164434275 19:28215564-28215586 CAAAGCTGAGAAATGTGAGTGGG + Intergenic
1165472369 19:36010843-36010865 CACAGCTCAGAAGTCTGAGTGGG + Intronic
1167455022 19:49593396-49593418 CATAGCTTTGCAGTGGGTGGGGG - Exonic
925379298 2:3414101-3414123 GATAGCTTAAAAATGTGTGAGGG - Intronic
937209392 2:120258683-120258705 CATGGCTTTGAAATGTATGTTGG + Intronic
939599488 2:144171244-144171266 CATAGCTTTGAAGTATGGGTAGG - Intronic
939680340 2:145123400-145123422 CCTAGCTAACTAGTGTGTGTAGG + Intergenic
940646512 2:156398118-156398140 CAAAAATTAGCAGTGTGTGTTGG - Intergenic
942672407 2:178390378-178390400 CAGAGCTTAGATGTGTGGGCTGG - Intronic
942983068 2:182105815-182105837 CATAGCGTTGAATTGTGTATGGG - Intronic
943419974 2:187658122-187658144 CAAAGCTTAGAATTGAGTTTGGG - Intergenic
945922959 2:215774558-215774580 TACAGCTTAAAAATGTGTGTGGG + Intergenic
947510515 2:230748887-230748909 CATAGCTAATAAGTGTGGATAGG - Intronic
948082691 2:235219717-235219739 CATAGATTTGAGGAGTGTGTTGG + Intergenic
1170471047 20:16668732-16668754 CATACCTAAGAGGTGGGTGTTGG - Intergenic
1171074107 20:22104486-22104508 CATAGCTGACAACTGTGTTTTGG + Intergenic
1171318167 20:24214234-24214256 CATAGGTTAGAAATGTGATTTGG - Intergenic
1171511746 20:25691472-25691494 TATAGTTGAGAAGTGTGTTTGGG - Intronic
1173326930 20:42042402-42042424 CATGGCTTAGAAATGTCTGAGGG - Intergenic
1173731025 20:45328726-45328748 CATAGATTTGTAGTGTGTGCAGG - Intronic
1174180793 20:48673072-48673094 CACAGGTTAGAAGAGAGTGTAGG - Intronic
1174824360 20:53755897-53755919 CATAGCTAAGAAATGTGTCCAGG - Intergenic
1174972745 20:55295393-55295415 CAAAACTTACAATTGTGTGTGGG + Intergenic
1175720605 20:61284581-61284603 CATATGTTATAAGTATGTGTTGG - Intronic
1177537412 21:22446474-22446496 CATAGCCTAGAATTATGTGCTGG - Intergenic
1177567564 21:22844267-22844289 CAAAGCTTAGAATTGAGTTTGGG + Intergenic
1180144092 21:45909963-45909985 CGTATCTGGGAAGTGTGTGTGGG - Intronic
1181835963 22:25608811-25608833 TATAGGTCAGAAGTGTGAGTGGG - Intronic
953238448 3:41126605-41126627 CATAGCATCCAAGTGGGTGTTGG - Intergenic
953850422 3:46462451-46462473 CATAGCTAATAAGTAAGTGTTGG + Intronic
954702260 3:52456421-52456443 CATAGCTTAGAAGTGTGTGTGGG - Intronic
955664491 3:61335894-61335916 CAGAGATGAGAAGTGTATGTAGG + Intergenic
955712850 3:61798308-61798330 CATAGTGGTGAAGTGTGTGTTGG - Intronic
958845056 3:99256472-99256494 CATAGGTGTGAAGTGTCTGTAGG - Intergenic
959918682 3:111847362-111847384 TACAGCTTAGAATTGTGTGCAGG + Intronic
960042129 3:113161546-113161568 CCAAGCTTAGACATGTGTGTAGG + Intergenic
960327472 3:116315104-116315126 CAAAGCCTGGAAGTGTGTTTAGG - Intronic
960590814 3:119363709-119363731 TCCAGCTTAGAATTGTGTGTAGG + Intronic
960991362 3:123313749-123313771 CATAGATGAGGAGTGTGTTTTGG - Intronic
964396621 3:156252617-156252639 CATAGATTAGAAGTGACTGATGG + Intronic
966252943 3:177887318-177887340 CACAGTTTAAAAGTATGTGTAGG - Intergenic
967328250 3:188264072-188264094 CATTGCTGAGCAGTTTGTGTTGG + Intronic
973059291 4:45700085-45700107 CATAGCGAACAAGTGTTTGTTGG - Intergenic
974753920 4:66179132-66179154 CACAGCTCAGAACTGTGTCTAGG - Intergenic
975472711 4:74788948-74788970 CAAAGCTAGGAAGTGTGTGTCGG + Intronic
975756531 4:77577379-77577401 CAAAGCTTAGAATTGAGTTTGGG - Intronic
976469647 4:85413449-85413471 CATAGCTTGAAAGTGGGTGCTGG + Intergenic
977670730 4:99692242-99692264 TATAGCTTAAAAGTGAGTGTAGG - Intergenic
978420961 4:108532394-108532416 CAAAGCTGAGCAGTGTGTGCTGG - Intergenic
978582677 4:110247951-110247973 CATAGCTTAGAGGTGGAGGTGGG + Intergenic
981255845 4:142659909-142659931 CAAAGCTTAGAATTGAGTCTGGG - Intronic
982885578 4:160776341-160776363 AAAAACTTAGAAGAGTGTGTAGG + Intergenic
983271967 4:165572907-165572929 TATATCTTAGAAATGTGTGAAGG + Intergenic
983830541 4:172321380-172321402 CATGGCTTATAAGTTTTTGTTGG - Intronic
985136043 4:186787188-186787210 GATTGTTTAGATGTGTGTGTAGG + Intergenic
987168339 5:15224737-15224759 CACAGCTTAGAAGAGTGTGGAGG + Intergenic
987543557 5:19284921-19284943 CAGAGGTTAGAAGAGTGTGAAGG - Intergenic
989405828 5:41059596-41059618 CATTGCTTGGAAATGTGTGGTGG - Intronic
990469399 5:56100397-56100419 CATTTCTAAGAAGTGTGTCTTGG + Intronic
990712274 5:58598368-58598390 TACAGCTTTGAAGTGTGTTTGGG - Intronic
991225522 5:64266268-64266290 CATAGAAAAGAAATGTGTGTGGG + Intronic
992162856 5:74019321-74019343 CAAAGCCTAGAAGTCTGGGTAGG + Intergenic
996829268 5:127721549-127721571 CATAGGTTAGAAGAGTTTGGAGG - Intergenic
997654764 5:135546558-135546580 CACAAATTAGCAGTGTGTGTTGG + Intergenic
998157135 5:139793443-139793465 CACAGCTAGGAAGTGTGGGTTGG + Intergenic
1000255824 5:159537351-159537373 CATGGCTGGGAATTGTGTGTCGG + Intergenic
1002695062 5:181081793-181081815 CAGAAATTAGAAGTGTATGTTGG - Intergenic
1002923507 6:1590839-1590861 CATAGCTCAGCACTGTGTTTGGG - Intergenic
1003510899 6:6779525-6779547 CATGATTTAAAAGTGTGTGTCGG - Intergenic
1003752718 6:9079153-9079175 TATAGCTTGGATGTGTGTTTAGG + Intergenic
1004147025 6:13077487-13077509 CACAGATCAGAAGTGTGTTTTGG + Intronic
1004165989 6:13256880-13256902 CAGAGATTGGAAGAGTGTGTAGG - Intronic
1004978087 6:20990856-20990878 CATTGCCTAGAAGTCTTTGTAGG + Intronic
1008966194 6:57315269-57315291 AATAGTATAGATGTGTGTGTAGG + Intronic
1010940226 6:81908018-81908040 CAAAGCTTAGCAGTGGGTATTGG - Intergenic
1012751519 6:103169004-103169026 GATAGTTTAAAAGTGTGTGGTGG + Intergenic
1014488332 6:122029339-122029361 CAAAGATTAGAAGTATGTGTTGG - Intergenic
1016802863 6:148184067-148184089 CAAAGGGTTGAAGTGTGTGTAGG + Intergenic
1018393405 6:163358288-163358310 TATATCTTTGAAGTGTGGGTTGG + Intergenic
1019401882 7:859475-859497 CAGCGCTGGGAAGTGTGTGTGGG + Intronic
1020725342 7:11806471-11806493 CAGAGCTTAAAAGTGGTTGTGGG + Intronic
1021758397 7:23878414-23878436 AGTAGCTAGGAAGTGTGTGTGGG + Intergenic
1031303852 7:120098965-120098987 GACAGATTATAAGTGTGTGTGGG + Intergenic
1033803197 7:144925449-144925471 CATAGATTATACGTGTGTGATGG + Intergenic
1036296566 8:7542715-7542737 CAGAGCTTAGCTCTGTGTGTTGG + Intergenic
1036326000 8:7778304-7778326 CAGAGCTTAGCTCTGTGTGTTGG - Intergenic
1038979205 8:32738229-32738251 CAGAGCATAGAAGTGGGTGATGG + Intronic
1042460865 8:69066569-69066591 CATAGCTTAGAAATTTCTGGAGG + Intergenic
1044723035 8:95168899-95168921 CAAAGTTTAGAAGTGGGAGTTGG + Intergenic
1045150941 8:99407099-99407121 TATAGCTGAGAATTGTCTGTAGG + Intronic
1046668060 8:117026916-117026938 CAGAGCTTTGATGTGTGTCTAGG + Intronic
1046985173 8:120380024-120380046 AACAACTCAGAAGTGTGTGTGGG + Intergenic
1048066391 8:130973582-130973604 CTTAGCTCACAAATGTGTGTTGG - Intronic
1048605994 8:135969575-135969597 CAAAGCTTAGGCGTGTTTGTGGG + Intergenic
1050529075 9:6572406-6572428 CTGAGTTTAGAGGTGTGTGTGGG + Intronic
1053550741 9:39077066-39077088 CATAGCTTAAAAATATGTTTTGG - Intronic
1053814852 9:41897160-41897182 CATAGCTTAAAAATATGTTTTGG - Intronic
1054615744 9:67290281-67290303 CATAGCTTAAAAATATGTTTTGG + Intergenic
1056339136 9:85606887-85606909 AAAAGCTGAGAAGGGTGTGTGGG + Intronic
1056841376 9:90000375-90000397 CATTTCTTTGAACTGTGTGTGGG + Intergenic
1059779222 9:117508576-117508598 CCTATCTTAGAGGTGTGTGAGGG + Intergenic
1060354851 9:122896022-122896044 CATAGCTCAGAGGTGTCTTTTGG + Intronic
1062082204 9:134630037-134630059 CTGAGCTCAGAAGTCTGTGTGGG + Intergenic
1186270825 X:7886416-7886438 CTCAGCTTAGAAGAGTGAGTGGG + Intergenic
1186890535 X:13955323-13955345 CTTTGCTAAGAAGTTTGTGTGGG + Intergenic
1190025117 X:46914927-46914949 CATAGCTAAGAAGTATGGATTGG + Intronic
1190959035 X:55227328-55227350 CAGAGGTTGGAAGTGTTTGTAGG + Intronic
1191143302 X:57137352-57137374 CATAGATGAGGAGCGTGTGTAGG + Intronic
1192024315 X:67432326-67432348 CATAGCTGAGAAGGGTTAGTGGG + Intergenic
1194809906 X:98376602-98376624 CAAAGCTTAGAATTGAGTTTGGG + Intergenic
1196349425 X:114708327-114708349 CATAGCTAAGAAGTGAAAGTTGG + Intronic
1196407918 X:115384801-115384823 TATAGCTCAAAAGTGTGTCTAGG - Intergenic
1198296819 X:135295522-135295544 CATAGGTAAGAAGTGGCTGTAGG + Intronic
1201933478 Y:19379584-19379606 CAAAGCTTAAATGTGTATGTGGG - Intergenic
1202093807 Y:21222512-21222534 CATAGGTTAGAAGAGTGTGGAGG + Intergenic
1202365021 Y:24154220-24154242 CAGAGCCTAGAAGAGTGTGACGG + Intergenic
1202505760 Y:25515902-25515924 CAGAGCCTAGAAGAGTGTGACGG - Intergenic