ID: 954702261

View in Genome Browser
Species Human (GRCh38)
Location 3:52456422-52456444
Sequence CCATAGCTTAGAAGTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954702261_954702271 22 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702271 3:52456467-52456489 GGTAGTTCCCGACTTTGACGGGG 0: 1
1: 0
2: 0
3: 0
4: 19
954702261_954702268 1 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702268 3:52456446-52456468 GGAGACAGAGGACAAATAGCGGG 0: 1
1: 0
2: 0
3: 31
4: 342
954702261_954702269 20 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG 0: 1
1: 0
2: 0
3: 2
4: 17
954702261_954702272 26 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702272 3:52456471-52456493 GTTCCCGACTTTGACGGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 34
954702261_954702270 21 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702270 3:52456466-52456488 GGGTAGTTCCCGACTTTGACGGG 0: 1
1: 0
2: 0
3: 1
4: 31
954702261_954702267 0 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702267 3:52456445-52456467 GGGAGACAGAGGACAAATAGCGG 0: 1
1: 0
2: 3
3: 41
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954702261 Original CRISPR CCATAGCTTAGAAGTGTGTG TGG (reversed) Intronic
904830917 1:33306452-33306474 CCTTAGCTTAGCAGTGAGCGAGG - Intergenic
905916963 1:41691125-41691147 CAAGGGCTTAGAAGTCTGTGTGG + Intronic
906120749 1:43389098-43389120 CCAGTGCTTAGAAGCATGTGTGG - Intronic
907526685 1:55057835-55057857 CCAAGGCTTAGAGGTGTGAGAGG + Intronic
909867317 1:80689485-80689507 CCATAGATTGGAAATTTGTGAGG - Intergenic
915072628 1:153283653-153283675 CCATAGCTGAGACGTGTGATTGG - Intergenic
915930972 1:160060889-160060911 CCCTAGCTAAGAAGGCTGTGGGG + Intronic
917204929 1:172562008-172562030 ATATTGCTTAGAAGTGTTTGGGG - Intronic
917496237 1:175542576-175542598 CCATTGCTTGGAGGTGTGGGTGG - Intronic
918143525 1:181737272-181737294 CCATGGCTCAGACGTGTCTGTGG + Intronic
920220885 1:204399610-204399632 CCAGAGCCTAGAACTGTGTCTGG - Intergenic
1064483197 10:15760030-15760052 CTAGAGCTTAGAATTGTGTCTGG + Intergenic
1067687247 10:48473765-48473787 CCATTGCATTGAAGTGTGAGAGG - Intronic
1067704575 10:48597406-48597428 CTGTAGCTTAGCAGTGGGTGAGG + Intronic
1069003250 10:63289814-63289836 CCATAATTTAGAAGTATTTGTGG - Intronic
1069173188 10:65258380-65258402 CAAAGGCTGAGAAGTGTGTGAGG + Intergenic
1070485949 10:76931643-76931665 CCAGAGGTTGGAAGTGTATGAGG + Intronic
1085050720 11:73378828-73378850 CCATGGCTTTGAAGAGTGTATGG + Intronic
1085867745 11:80315014-80315036 GCACTGCTTAGAAATGTGTGAGG - Intergenic
1087111547 11:94474955-94474977 CCAGAGTTTAGATATGTGTGTGG - Intronic
1087232813 11:95685022-95685044 ACACAGCTTAGCAGTCTGTGGGG + Intergenic
1088545050 11:110950777-110950799 ACATAGATTAGAAATGTCTGAGG - Intergenic
1095618869 12:44225209-44225231 CTATATTTTAGAAGTGTGAGGGG - Intronic
1098476435 12:70909310-70909332 ACATATCTTTGATGTGTGTGTGG - Intronic
1098805625 12:75017210-75017232 CCAAAGCTTAGAATTGAGTCTGG + Intergenic
1103964741 12:124631742-124631764 CCAGGGCCTAGAATTGTGTGTGG - Intergenic
1105734320 13:23252225-23252247 CTATAGCTTTCAAGTGTTTGAGG + Intronic
1106695577 13:32169154-32169176 CCAAAGCATAGAAGTGTGGTGGG - Intronic
1113708703 13:112450246-112450268 GGAGAGCTGAGAAGTGTGTGCGG - Intergenic
1114277786 14:21163314-21163336 CAATAACTTAAAAGTTTGTGTGG + Intergenic
1114561315 14:23593218-23593240 CCATAGCTTTGTAGTGTATTTGG + Intergenic
1115631212 14:35247438-35247460 CCATAGTGTACAACTGTGTGGGG + Intronic
1115738360 14:36360017-36360039 CCATAGGTTACATGTTTGTGTGG + Intergenic
1116473096 14:45307986-45308008 CCAAAGTTTTGAAGTGTGTAAGG + Intergenic
1117557686 14:56902712-56902734 GCATAGCTTAGAAGAGTTTCAGG - Intergenic
1118037108 14:61879648-61879670 CCATGGATTAGAGGTCTGTGGGG - Intergenic
1118348191 14:64955017-64955039 ACATAGCTAAGAAGTGAGGGAGG - Intronic
1126547475 15:49888939-49888961 TCATAGCTTAGAGCTGTGGGAGG - Intronic
1126685437 15:51245040-51245062 CCATAGGTTATAAGTGTGTAGGG - Intronic
1127372515 15:58354681-58354703 CGATGGCTTGGAAGTCTGTGTGG - Intronic
1129064279 15:72888373-72888395 CAATAGCTGATAGGTGTGTGGGG + Intergenic
1138241258 16:55428891-55428913 CCATTGCTCACAAGTGGGTGGGG + Intronic
1143332873 17:6150329-6150351 CCATGAATTAGAAGTGGGTGTGG + Intergenic
1144404011 17:14934932-14934954 CCATTGTTTAGTAGTGAGTGGGG - Intergenic
1147541623 17:41365081-41365103 CAAGAGCTAAGAAGAGTGTGTGG + Intronic
1149284660 17:55149139-55149161 TCATAGCTAAGAAGTATTTGGGG - Intronic
1152632799 17:81418075-81418097 CCACAGCCTGGAAGTGTCTGAGG - Intronic
1155709260 18:28855621-28855643 CCAGAGCTTAGAAGAGTGCCTGG + Intergenic
1156665375 18:39399106-39399128 CAATAGCTTAGATATGTGTAGGG - Intergenic
1159639830 18:70850575-70850597 GAATAGCAAAGAAGTGTGTGTGG - Intergenic
1160420934 18:78743451-78743473 CCTTAGCTAACAAGTTTGTGGGG - Intergenic
1162142575 19:8593459-8593481 ACATAGCTTAAAAGTGTTGGGGG - Intronic
1163821332 19:19498169-19498191 CTATAGATTTTAAGTGTGTGCGG + Intronic
1164147354 19:22520095-22520117 CCAGAGCTTGGGAGTGTGAGAGG - Intronic
1164159244 19:22616015-22616037 CCAGAGCTTGGGAGTGTGAGAGG + Intergenic
1167455023 19:49593397-49593419 GCATAGCTTTGCAGTGGGTGGGG - Exonic
925379299 2:3414102-3414124 AGATAGCTTAAAAATGTGTGAGG - Intronic
925621041 2:5793184-5793206 CCAAAGCTTGGAAGAGTCTGTGG - Intergenic
926709904 2:15870882-15870904 CCAAAGTTGAGAAGTGTGTGTGG + Intergenic
936022589 2:109006084-109006106 CCATAGCAGAAACGTGTGTGGGG + Intergenic
939196520 2:138979742-138979764 CCATAACTTAGAATTGTTTGAGG + Intergenic
940757433 2:157699258-157699280 CCACAGCTGGGAAATGTGTGGGG + Intergenic
942983069 2:182105816-182105838 CCATAGCGTTGAATTGTGTATGG - Intronic
943419975 2:187658123-187658145 CCAAAGCTTAGAATTGAGTTTGG - Intergenic
947038092 2:225882867-225882889 CCAGAGCTTAGTATTGTTTGTGG + Intergenic
947877684 2:233478667-233478689 CGACAGCCTGGAAGTGTGTGAGG + Intronic
948443264 2:238011517-238011539 CCAGGGCCTAGAACTGTGTGTGG + Intronic
1169886668 20:10406511-10406533 ACATAGCTTAGGAGTGTGGTAGG + Intronic
1170057425 20:12222031-12222053 CTATATCATAGAAGTGTTTGAGG + Intergenic
1170876242 20:20252964-20252986 CTTTAGCTTAGAAGCATGTGGGG - Intronic
1172361169 20:34313452-34313474 AAAGAGCTTAGAATTGTGTGTGG - Intergenic
1173326931 20:42042403-42042425 CCATGGCTTAGAAATGTCTGAGG - Intergenic
1176158891 20:63638525-63638547 CCATGTCTTAGAAGGGTGTCTGG - Intergenic
1177567563 21:22844266-22844288 CCAAAGCTTAGAATTGAGTTTGG + Intergenic
1180117566 21:45720937-45720959 CCATAGCTTGGCTGGGTGTGGGG + Intronic
1180144093 21:45909964-45909986 CCGTATCTGGGAAGTGTGTGTGG - Intronic
1181835964 22:25608812-25608834 CTATAGGTCAGAAGTGTGAGTGG - Intronic
1182354728 22:29717553-29717575 CAAAAGCTCAGAAGTGTGAGAGG - Intergenic
1183749695 22:39712815-39712837 CCATAGCTTTGTCGTGTGTGGGG + Intergenic
954702261 3:52456422-52456444 CCATAGCTTAGAAGTGTGTGTGG - Intronic
954703558 3:52465854-52465876 CAATGGCTTAGAAGAGTGTTGGG + Intronic
955191822 3:56768816-56768838 GCATAGCTTGGAAATGTGTGAGG + Intronic
955967344 3:64402202-64402224 CCAAAGCTCAGAAGGGTGAGTGG - Intronic
957115335 3:76016926-76016948 GCATAGGATAGCAGTGTGTGAGG + Intronic
963757644 3:149252339-149252361 CCATATCAAAGAACTGTGTGGGG - Intergenic
965010859 3:163088840-163088862 CCATAGCTTGGAATTATGGGTGG + Intergenic
966438399 3:179916260-179916282 ATATAGCTTAGATGTGTATGAGG - Intronic
974675055 4:65078655-65078677 CCAAAGCTTAGAATTGAGTCTGG - Intergenic
974797310 4:66769277-66769299 CCACTGGTTAGAAGTGAGTGTGG - Intergenic
976713997 4:88103724-88103746 CCAGAGGCTAGAGGTGTGTGGGG - Intronic
979344643 4:119572453-119572475 CCATATCTGAGAACTTTGTGTGG + Intronic
980905149 4:138941103-138941125 ACATATCGTAGAAGTGTGTCAGG - Intergenic
981255846 4:142659910-142659932 CCAAAGCTTAGAATTGAGTCTGG - Intronic
983554966 4:169051764-169051786 CCAGTGCCTAGAAGAGTGTGTGG - Intergenic
983926680 4:173410177-173410199 CCAGAGCGTAGAGGTTTGTGGGG + Intergenic
990712275 5:58598369-58598391 CTACAGCTTTGAAGTGTGTTTGG - Intronic
995927890 5:117397394-117397416 ACATAGCATAGAAATCTGTGTGG + Intergenic
997138915 5:131357563-131357585 GCAAAGCTTATAAATGTGTGAGG + Intronic
998163075 5:139824319-139824341 TCATAGATTAGAAGTGGGTTGGG + Intronic
999772152 5:154783725-154783747 CCAGAGTTTAGAACAGTGTGTGG + Intronic
1008289200 6:49692956-49692978 CCATACATTCAAAGTGTGTGGGG + Intronic
1011013091 6:82724003-82724025 CCATAGGTCAGAAGTCTGAGAGG + Intergenic
1011827843 6:91331639-91331661 CCATAGTTGGAAAGTGTGTGTGG + Intergenic
1012592288 6:100996950-100996972 CCAGAGCTTAGAACAATGTGTGG + Intergenic
1013936836 6:115606375-115606397 CTATACCTTAGAAGTTTCTGAGG - Intergenic
1019210260 6:170399151-170399173 TCATAACTTAGGAGTGAGTGGGG + Intronic
1019210312 6:170399656-170399678 TCATAACTTAGGAGTGAGTGGGG + Intronic
1019210334 6:170399849-170399871 TCATAACTTAGGAGTGAGTGGGG + Intronic
1020618157 7:10485861-10485883 CCAAAGCCTAGAACTGTGTCTGG + Intergenic
1030013211 7:105191646-105191668 CCAGGACTTAGAAGTGTGTGGGG + Intronic
1033029967 7:137816557-137816579 CTAGAGCTTAGAATAGTGTGAGG - Intronic
1037492713 8:19411141-19411163 GCACAGCTTAGTGGTGTGTGGGG - Intronic
1040600312 8:48877657-48877679 CCATAGCCTAGAAATGTGGTAGG + Intergenic
1042655511 8:71091410-71091432 CCACTGCTCAGAACTGTGTGAGG - Intergenic
1042874569 8:73429121-73429143 CAATAGCTTATAAGTATGAGAGG + Intronic
1046420781 8:113980463-113980485 CATTAGCCTAGAAGTGTTTGGGG + Intergenic
1047222068 8:122926681-122926703 CCAGAGCTTCCAAGTGAGTGTGG - Intronic
1056295461 9:85188834-85188856 CTCTAGCTTAGTAGTGGGTGTGG + Intergenic
1056339135 9:85606886-85606908 CAAAAGCTGAGAAGGGTGTGTGG + Intronic
1059435348 9:114272673-114272695 AAATAGCTTAGCAGTGTGTCTGG - Intronic
1059708763 9:116848106-116848128 GCATAGCCTAGCAGTGTGTCTGG - Intronic
1059779220 9:117508575-117508597 TCCTATCTTAGAGGTGTGTGAGG + Intergenic
1060808654 9:126596006-126596028 CCATAGATTCCAAGTGTTTGGGG - Intergenic
1062007060 9:134244466-134244488 CAATAGCTGAGCAGTCTGTGGGG - Intergenic
1062082203 9:134630036-134630058 CCTGAGCTCAGAAGTCTGTGTGG + Intergenic
1186291696 X:8107440-8107462 CCATAGCCTAGCAATTTGTGGGG + Intergenic
1186547549 X:10466376-10466398 ACATAGTATAGTAGTGTGTGTGG + Intronic
1187559120 X:20383287-20383309 ACATAGGTTAGATGTATGTGAGG + Intergenic
1194182972 X:90736311-90736333 CCATAGCTTATAAGTCTTTGTGG - Intergenic
1194809905 X:98376601-98376623 CCAAAGCTTAGAATTGAGTTTGG + Intergenic
1194936661 X:99958275-99958297 CCATAGAATAGAATTGTTTGAGG - Intergenic
1197343483 X:125303022-125303044 CCATTGGTTAGAAGTGTGAGTGG - Intergenic
1198122309 X:133606278-133606300 CAATAGCTTAGAAGTGTATAGGG + Intronic
1198135128 X:133741735-133741757 AAAGAGCTTAGAATTGTGTGAGG + Intronic
1198147613 X:133873170-133873192 CCAGAGTTTAGAAGACTGTGTGG - Intronic
1199243943 X:145580833-145580855 CCAGAGGTTTGAAGGGTGTGAGG - Intergenic
1200529592 Y:4318268-4318290 CCATAGCTTATAAGTCTTTGTGG - Intergenic
1201933479 Y:19379585-19379607 CCAAAGCTTAAATGTGTATGTGG - Intergenic