ID: 954702261

View in Genome Browser
Species Human (GRCh38)
Location 3:52456422-52456444
Sequence CCATAGCTTAGAAGTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954702261_954702271 22 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702271 3:52456467-52456489 GGTAGTTCCCGACTTTGACGGGG 0: 1
1: 0
2: 0
3: 0
4: 19
954702261_954702270 21 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702270 3:52456466-52456488 GGGTAGTTCCCGACTTTGACGGG 0: 1
1: 0
2: 0
3: 1
4: 31
954702261_954702267 0 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702267 3:52456445-52456467 GGGAGACAGAGGACAAATAGCGG 0: 1
1: 0
2: 3
3: 41
4: 431
954702261_954702269 20 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG 0: 1
1: 0
2: 0
3: 2
4: 17
954702261_954702268 1 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702268 3:52456446-52456468 GGAGACAGAGGACAAATAGCGGG 0: 1
1: 0
2: 0
3: 31
4: 342
954702261_954702272 26 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702272 3:52456471-52456493 GTTCCCGACTTTGACGGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954702261 Original CRISPR CCATAGCTTAGAAGTGTGTG TGG (reversed) Intronic