ID: 954702267

View in Genome Browser
Species Human (GRCh38)
Location 3:52456445-52456467
Sequence GGGAGACAGAGGACAAATAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 431}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954702261_954702267 0 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702267 3:52456445-52456467 GGGAGACAGAGGACAAATAGCGG 0: 1
1: 0
2: 3
3: 41
4: 431
954702260_954702267 1 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702267 3:52456445-52456467 GGGAGACAGAGGACAAATAGCGG 0: 1
1: 0
2: 3
3: 41
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954702267 Original CRISPR GGGAGACAGAGGACAAATAG CGG Intronic
900374084 1:2345389-2345411 GGGGGACACAGGACAATTCGGGG + Intronic
900623014 1:3596048-3596070 GGGAGACAGAGGAGACCTGGAGG + Intronic
900763511 1:4488448-4488470 GTGAGGCAGGGGAAAAATAGAGG + Intergenic
900807780 1:4779084-4779106 AGGAGACAGAAGTAAAATAGGGG + Intronic
901422801 1:9162348-9162370 GGGGGACAGAGGAAAAATCCTGG + Intergenic
902448982 1:16484853-16484875 TGGAGACAGAGGACGGAGAGGGG - Intergenic
903834434 1:26193758-26193780 GGGAGACAGAGAAAAAAGAGGGG - Intronic
903914016 1:26749926-26749948 GAAAGAAAGAGGACTAATAGAGG + Intronic
904429552 1:30453228-30453250 TGGAAAAAGAGGACAAATGGGGG + Intergenic
904652453 1:32015474-32015496 GGGAGACAGAGAACAAAGGGAGG - Intronic
905126772 1:35720863-35720885 GAGAGACAGAGTCCAAAGAGAGG - Intronic
905133900 1:35783025-35783047 GGGAGACAGAGGAAAAAACAAGG - Intergenic
908084955 1:60622093-60622115 GGGAGACACAGGGGAAAGAGAGG - Intergenic
909706206 1:78587818-78587840 GGGACTCAAAGGACAGATAGGGG + Intergenic
909728902 1:78870718-78870740 GGGAGAAATAGGCCAAATAAAGG + Intergenic
910590680 1:88925724-88925746 GAGAGACAGAGGAGAGACAGAGG + Intergenic
910640991 1:89461745-89461767 GTAAGACAGAGTACAAATTGGGG - Intergenic
910712381 1:90195344-90195366 GAGGGAGAGAGGACATATAGTGG - Intergenic
912468570 1:109890962-109890984 AGGGGAGAGAGGACAAAGAGAGG + Intergenic
914734824 1:150405807-150405829 TGGATACAAAGGACAAAGAGAGG - Intronic
915061661 1:153190976-153190998 GAGAGACAAAGGACAAATGGAGG + Intergenic
915162676 1:153931107-153931129 GGGAGGCAGAGGACAAGAAACGG + Intronic
916212440 1:162369837-162369859 GGGAGACAAAGGACAGATCTAGG + Exonic
916602395 1:166305941-166305963 AGGAAGTAGAGGACAAATAGAGG + Intergenic
916904061 1:169262595-169262617 GGAACACAGAGAACAAAGAGGGG + Intronic
918003862 1:180523824-180523846 GGGAGACAGAGAACAAAGGAGGG + Intergenic
919842534 1:201619675-201619697 GGGAGACTGTGGGCAAGTAGAGG + Intergenic
920501461 1:206488014-206488036 GGGAGACAGAGGAGAGAGAAGGG - Intronic
921132068 1:212228305-212228327 GGGAGAGAGAGGACACATGGGGG + Intergenic
921263390 1:213403294-213403316 GGGAGACAGAGGGAAGAAAGTGG + Intergenic
921340791 1:214132307-214132329 GGGAGGCAGAGAACAGAGAGCGG - Intergenic
922079257 1:222278954-222278976 GGGAGGCAGAGGGGAATTAGTGG + Intergenic
922201155 1:223402570-223402592 AAGAGACAGAGGAGAAATAGAGG - Intergenic
922216561 1:223524825-223524847 TGGAGACAAAGGCCAAACAGGGG + Intergenic
922349068 1:224721090-224721112 GGAAGCCAGAGGACAAACCGAGG - Intronic
922694167 1:227719692-227719714 GAGAGACAGAGGAGAAAAAGAGG - Intergenic
923918154 1:238531733-238531755 GAGAGACAGTGGGAAAATAGAGG + Intergenic
924183164 1:241459622-241459644 GGGAGACAGAAAACAAGCAGAGG + Intergenic
1064485703 10:15786654-15786676 GGGAGAAAGAAGAAAAACAGTGG + Intronic
1064849796 10:19697857-19697879 GGGAGACAGAAGAAAAATTGAGG - Intronic
1064990592 10:21253428-21253450 GGCACACAGAGGAAAAATATTGG + Intergenic
1065360630 10:24885995-24886017 GGGAGAAAGAGGAAAAACACAGG + Intronic
1065377466 10:25058163-25058185 GAGTGATAGAGGACAAGTAGAGG - Intronic
1065681968 10:28245138-28245160 GAGATACAGAGCAAAAATAGTGG - Intronic
1067194627 10:44105785-44105807 TTGAAACACAGGACAAATAGGGG + Intergenic
1067475625 10:46564064-46564086 GGAAGGCAGTGGACAAAGAGGGG + Intergenic
1067619111 10:47777711-47777733 GGAAGGCAGTGGACAAAGAGGGG - Intergenic
1068108585 10:52651583-52651605 GGCTGGCAGAGGACAAATTGTGG + Intergenic
1069757960 10:70785339-70785361 AGGAGCAAGAGGACAAATCGAGG + Exonic
1069772268 10:70907480-70907502 TGGGGACAGATGAGAAATAGAGG - Intergenic
1072531170 10:96320922-96320944 GAGAGACAGAGGAGAGAGAGAGG - Intronic
1073372940 10:103007055-103007077 GAGAAATAGAGTACAAATAGAGG + Intronic
1073510604 10:104040298-104040320 GGTAAACAGAGGACACATACTGG + Intronic
1074341485 10:112634990-112635012 GGCAGACAGAGGAGCATTAGAGG + Intronic
1074463738 10:113663892-113663914 GGAAGAGAGAGGACAAAGATAGG + Exonic
1074567208 10:114590903-114590925 GGGAGGCAGAGGACAAAAGGAGG - Intronic
1075347725 10:121696554-121696576 GGGAGAAAGTGGAATAATAGTGG - Intergenic
1075406499 10:122199140-122199162 GGGAGACAGAGGAAAGGTATAGG - Intronic
1077341203 11:2027163-2027185 GGGAGACAGGGGACAGAGACAGG + Intergenic
1077373962 11:2196716-2196738 GGGAGACAGAAGAGAGATGGAGG - Intergenic
1077896488 11:6457220-6457242 GGAAGACAGAGGAACAATGGAGG + Intronic
1078818917 11:14856162-14856184 GGGAGAGAGAGCACACACAGGGG - Intronic
1078898657 11:15621254-15621276 GGGAGAGAGAGGACAAAGGCGGG - Intergenic
1079102896 11:17552566-17552588 GGGAGACACAGGACAGGTGGGGG - Intronic
1081157326 11:39710433-39710455 GAGAGAGAGAAGACAAATAGAGG + Intergenic
1081647285 11:44798916-44798938 GTGAGACTGAGGCCAACTAGGGG + Intronic
1083039495 11:59671807-59671829 GGGAGACTGAGGACGAAAATAGG + Intergenic
1083705152 11:64509080-64509102 GGGGGCCAGAGGACACATGGGGG - Intergenic
1084712686 11:70853634-70853656 GGGAGACAGAGTGAAAATACAGG + Intronic
1085181494 11:74540713-74540735 GGGAGTCAGTGGACAAGTGGTGG - Intronic
1085197642 11:74682118-74682140 TGCAGACACAGGGCAAATAGGGG + Intergenic
1085237698 11:75027994-75028016 GGGAAACAGAGGAGAGATGGGGG - Intergenic
1086920308 11:92579300-92579322 GGGAGGCAGATGGCAACTAGAGG + Intronic
1088971720 11:114780053-114780075 GGGAGGCAGTGGACACATGGGGG - Intergenic
1089617433 11:119702864-119702886 TGGAGAAAGAGGAAAAAAAGAGG - Intronic
1090704052 11:129320687-129320709 GGGTGGGAGAGGACAAAAAGGGG - Intergenic
1090714206 11:129415876-129415898 GGAAGACAGAGGAAAACTGGTGG - Intronic
1091104660 11:132907331-132907353 AGCAGACAAAGGACAAATGGAGG - Intronic
1202824188 11_KI270721v1_random:82352-82374 GGGAGACAGGGGACAGAGACAGG + Intergenic
1091551406 12:1537888-1537910 AGCAGACAGAGGACCAATAAGGG - Intronic
1091656311 12:2349087-2349109 GGGAAACTGAGGCCTAATAGAGG + Intronic
1091701572 12:2666804-2666826 GGGAGGGAGAGGGAAAATAGGGG + Intronic
1091714715 12:2768686-2768708 GGGAGGCAGAGGACATAGGGAGG - Intergenic
1091828265 12:3531447-3531469 GGGAGACAAGTGACTAATAGTGG + Intronic
1091863767 12:3811455-3811477 GGGAGACAGAGGAGAATGACAGG + Exonic
1092596055 12:10005748-10005770 AGGAGACAGAGGATGAATATAGG - Intronic
1092931483 12:13319941-13319963 GGGAGACAGAGAACAAAGGAAGG + Intergenic
1093807091 12:23447773-23447795 GGGAGAGAGAGAAAAAATACAGG - Intergenic
1093891564 12:24527330-24527352 TGGAGAAAGAAGACAAATAAAGG + Intergenic
1094689334 12:32753585-32753607 GAGAGACAAAGGAAAAATAAGGG + Intronic
1095659768 12:44717904-44717926 GGGGGACAGAGGACAAAGAATGG + Intronic
1096029307 12:48397831-48397853 GGGAGACTGAGGCCCAATGGGGG + Intergenic
1096232758 12:49905568-49905590 GGGGGACAAAGGGCAAAAAGGGG - Intergenic
1096693714 12:53335941-53335963 GGGAGGGAGAGGAGAAAAAGGGG + Intronic
1096973701 12:55686381-55686403 GGAAGACAGAGCAGAGATAGGGG - Intronic
1097222722 12:57460295-57460317 GGGACATAGAGGCAAAATAGGGG + Intronic
1097708679 12:62895162-62895184 GTGATAAAGAGGACACATAGTGG - Intronic
1098599427 12:72312836-72312858 GGGAGGAAGGGGAAAAATAGTGG - Intronic
1098742348 12:74189713-74189735 AGGAGACAGAAGAGAAAGAGAGG - Intergenic
1101114757 12:101521262-101521284 GGGAGGCAGAAGACAAGTGGTGG + Intergenic
1101572091 12:105962977-105962999 GGGACACAGAGGAGAAGTAAAGG + Intergenic
1102406853 12:112680903-112680925 GGAAGACAGAGGAGAAGAAGAGG - Intronic
1104301420 12:127568512-127568534 GTGAGAAAGAGGAGAAAGAGAGG + Intergenic
1104479923 12:129098892-129098914 GGGAGACAGAGGATTAAGAGAGG - Intronic
1106398483 13:29404507-29404529 AGGAGACGGGGGACAAATACTGG - Intronic
1107216268 13:37922694-37922716 GAGAGACAAAGGTCAAATTGAGG - Intergenic
1107251470 13:38368563-38368585 GGTAGACTGAGGACAAGGAGAGG - Intergenic
1107344375 13:39443212-39443234 GAGAGACAGAGGAAGAAAAGGGG - Intronic
1107960372 13:45552293-45552315 TGGGGACAGGGGACAATTAGAGG - Intronic
1108412029 13:50159257-50159279 GGGTCACAGAAGACAAATATAGG + Intronic
1110668618 13:78148608-78148630 GGGAGACAGAAAACGAATAGAGG - Intergenic
1111758260 13:92426767-92426789 GGAGGACAGAGGGCAAAAAGTGG + Intronic
1113618033 13:111694871-111694893 GGGAGACAGCGGAGAGAGAGAGG - Intergenic
1113623566 13:111780132-111780154 GGGAGACAGCGGAGAGAGAGAGG - Intergenic
1113640441 13:111953369-111953391 TGGAGAGGGAGGACACATAGTGG + Intergenic
1114519673 14:23325304-23325326 AGGAGAGAGAGGAAAAAAAGAGG + Exonic
1114614929 14:24063246-24063268 GGGAGACAGAGAAAAAATCAAGG - Intronic
1115086511 14:29521925-29521947 GGGAGAAAGAGGAAAAACAAAGG - Intergenic
1115766077 14:36624906-36624928 TGGATCCAGAGGACAAATAAAGG + Intergenic
1116544032 14:46140444-46140466 GAGAGACAGAGAACAAAAAAAGG - Intergenic
1117480277 14:56136748-56136770 AGGAGAAAGAGGAGAAAAAGAGG - Intronic
1117670197 14:58098714-58098736 GGGAGGCACAGGGCAAATACAGG + Intronic
1118482262 14:66179187-66179209 GGGATAAAGAGCACAAAGAGTGG - Intergenic
1120699504 14:87683161-87683183 GGGAGACTGAGGACATTCAGGGG + Intergenic
1122145759 14:99688024-99688046 GGAAGACAGAGGGCACAGAGAGG - Intronic
1122288552 14:100667249-100667271 GGGAGGCAGAGGACAAAGCCTGG + Intergenic
1125183995 15:36909932-36909954 AGGAGACAAAGGAGAAATAGAGG + Intronic
1125573166 15:40736598-40736620 GGGAGACAAAGAACAAATCTAGG + Intronic
1125635874 15:41188304-41188326 GGGAGAGGGAGGAAAAAGAGGGG - Intronic
1127260397 15:57323046-57323068 GGGAGGCAGAAGAGAAACAGGGG + Intergenic
1127292170 15:57580663-57580685 GGAAGAGAGAGGACACACAGAGG - Intergenic
1127630318 15:60821511-60821533 GGAATACAGAGGAGAGATAGGGG - Intronic
1127854324 15:62942269-62942291 GGAAGACAGAGGAGAAAGAAAGG + Intergenic
1129057434 15:72830997-72831019 GTGACACAGAGGACAAACATGGG - Intergenic
1129184340 15:73896822-73896844 GGGAAACTGAGGACTAATGGGGG - Intergenic
1129219310 15:74122191-74122213 GGGAGACAGAGGCCAAAGAGAGG - Intronic
1129670078 15:77602812-77602834 GGGAGACAGATTCCAAAGAGGGG - Intergenic
1130106062 15:80929346-80929368 GGGAGAGAGAAGTCAAAAAGTGG + Intronic
1130377108 15:83338978-83339000 GGGAGAAAGAGTACTAATATTGG - Intergenic
1131075262 15:89491362-89491384 GGAAGCAAGAGGACAAATTGGGG - Intronic
1132072175 15:98787914-98787936 GGGAGACAAAAGAGAAATGGGGG + Intronic
1132342456 15:101087045-101087067 TGGAGACAGAGGAGAAGGAGGGG + Intergenic
1133842796 16:9425190-9425212 GGGAGAGAGAGGAGGAAGAGGGG + Intergenic
1134083761 16:11342481-11342503 GGGACACAGAGTAGAAATGGAGG - Intronic
1134108214 16:11499097-11499119 GGGAGAAAGGGGGCAAAGAGAGG + Intronic
1134536860 16:15033377-15033399 GGGAGATAGAGGAGAACTCGAGG + Exonic
1136580739 16:31149501-31149523 GGGAGCCAGAGGGGAAAGAGAGG + Intronic
1137733246 16:50705355-50705377 GGGAGATAGAAGCCAAAAAGGGG - Intronic
1138242592 16:55439802-55439824 GGCAGAGAGAGGACAGAAAGAGG + Intronic
1138281492 16:55775207-55775229 GAGAGACAGAGGAGAGAAAGAGG - Intergenic
1138291079 16:55847232-55847254 GGGAGAGAGAGAAGAAAAAGAGG - Intronic
1138315034 16:56062566-56062588 GGAAGACAAAGGCCAAAAAGAGG - Intergenic
1139415018 16:66801232-66801254 GGGAGTCAGAAGTGAAATAGGGG + Intronic
1140937140 16:79683818-79683840 AGGAGAAAGAGAAGAAATAGAGG - Intergenic
1140973201 16:80033338-80033360 GAGAGAAAGAGGAGAAAAAGGGG + Intergenic
1141011787 16:80407688-80407710 GGCAAACAGAGGGCAAAGAGAGG + Intergenic
1141098709 16:81181278-81181300 GGCAGACAGAGGACAGAGTGAGG + Intergenic
1143792368 17:9307794-9307816 GTGACTCAGAGGACAAAGAGGGG - Intronic
1144782251 17:17814044-17814066 GGGAAACTGAGGCCAGATAGGGG + Intronic
1144909176 17:18666783-18666805 GGGAGGCAGAGTACTACTAGAGG - Intronic
1148211693 17:45812754-45812776 GGGAGACAGAGGAAAAAAGATGG - Intronic
1149208880 17:54280745-54280767 GGTATTCACAGGACAAATAGAGG + Intergenic
1149288591 17:55193622-55193644 GGGAGGAAGAGGACAAAAAAAGG + Intergenic
1149536557 17:57438116-57438138 GGGAGACAGTGCACCAGTAGAGG + Intronic
1149616763 17:58007278-58007300 GGGAGACAGAGGAAGAGAAGCGG + Exonic
1150537197 17:66055095-66055117 AAGAGAGAAAGGACAAATAGAGG + Intronic
1150551630 17:66216033-66216055 GCTAGACAGAGCACAAAAAGGGG + Intronic
1151296404 17:73189602-73189624 GGGAGGCAGAGGACAAGGAAAGG + Intergenic
1152312146 17:79557925-79557947 GGGAGACAGAGGAGACCTGGAGG + Intergenic
1155916872 18:31565791-31565813 GAGAGGCAGAAGAGAAATAGTGG - Intergenic
1156489202 18:37486312-37486334 GGGAGACTGAGGCCAGAAAGAGG - Intronic
1156510319 18:37631023-37631045 CAGACACAAAGGACAAATAGTGG - Intergenic
1156894529 18:42230214-42230236 GGGAGGAAGAGGAAAAGTAGGGG + Intergenic
1157240323 18:46003336-46003358 TGGCAACAGAGAACAAATAGGGG - Intronic
1157869991 18:51221172-51221194 GGGAGTCAGAGGAAAAGGAGGGG + Intergenic
1158748863 18:60235328-60235350 GAGAGACAGGGGAAAGATAGGGG - Intergenic
1159430955 18:68352661-68352683 GAGAGAAAAAGGAGAAATAGGGG - Intergenic
1160719462 19:590876-590898 GGGGCAGAGAGGACGAATAGAGG + Intronic
1161262604 19:3346113-3346135 GGGAGAAGGAGGGCAAAAAGGGG - Intergenic
1161782552 19:6302926-6302948 AGGAGCCAGAGGACAGATACTGG + Intergenic
1162071896 19:8157904-8157926 GAGAGAGAGAGGAGAAAGAGAGG + Intronic
1162585517 19:11555844-11555866 GAGAGACAGAGGAGACATGGCGG + Intronic
1163319065 19:16561771-16561793 GGGAGACACAAGACAAAGAGGGG + Intronic
1163444508 19:17338748-17338770 GGGAGAGAATGGACAAATGGGGG - Intronic
1163726031 19:18923614-18923636 GGAAAACAGAGGAGAAAGAGGGG - Intronic
1164324306 19:24178634-24178656 GGGAGACAGAGGGCAGAAAGTGG + Intergenic
1164324767 19:24181441-24181463 AGGAGACAGAGGAGAAAAAGGGG + Intergenic
1164673889 19:30089235-30089257 AGGAGACAGAAGACATACAGAGG - Intergenic
1165377415 19:35452576-35452598 GGGAGAGAGAGGACAAAGCAAGG - Intergenic
1166345260 19:42161717-42161739 GGGAGAGACAGGACAGATGGAGG - Intronic
1166609884 19:44181738-44181760 GGGAGACTGACTTCAAATAGAGG - Intergenic
1167148474 19:47695931-47695953 GGGAGACAGAAGACAAGGAGAGG + Intronic
1167191235 19:47991572-47991594 GGGAGACAGAGGGGAAAGAGAGG - Intronic
1167414011 19:49361121-49361143 GGGAGACAGAGACCAGAAAGAGG + Intronic
1167428664 19:49442385-49442407 TGGAGACAGAACTCAAATAGAGG - Intergenic
1167799102 19:51728792-51728814 GAGAGACAGAGGAGAAAAGGAGG + Intergenic
1167924296 19:52810723-52810745 AGGAGAGAGAGGAAAAAAAGAGG + Intronic
1168115246 19:54218616-54218638 GGAAGAGAGGGGACAAATGGGGG - Intronic
1168168267 19:54569922-54569944 GAGAGACAGGGGCCAAGTAGAGG + Intergenic
1168498739 19:56875759-56875781 GGCAGACAGAGGAGAGAGAGGGG - Intergenic
1168606841 19:57767149-57767171 GGGTGACAGAGGACAGAGTGAGG - Intergenic
925077175 2:1026725-1026747 GGGAGACAGAGGTGGAATCGGGG - Intronic
926047671 2:9721799-9721821 CAGACACAGAGGACAAAAAGTGG - Intergenic
926931694 2:18047534-18047556 TGGAGACACTGGACAAAGAGAGG - Intronic
928448690 2:31357557-31357579 GGGGGACAGAGGATAAAATGGGG + Intronic
929338161 2:40777711-40777733 GGGAGAAAGAGGACAACAACTGG + Intergenic
929382124 2:41365500-41365522 AGGAGACAGAGAACAAATTCGGG + Intergenic
929441027 2:41965901-41965923 GGGAGACAGAGGAGAGAGAGTGG + Intergenic
929458365 2:42083043-42083065 GGAAGACAGGGGACATTTAGGGG - Intergenic
929747611 2:44675157-44675179 GGGATACAGAGGAGAAAGATGGG - Intronic
930097933 2:47581102-47581124 GGGAGACAGAAGACAAAAGCTGG + Intergenic
930421344 2:51156949-51156971 GGGAGACAGAGGAAATATAGTGG + Intergenic
931269419 2:60688467-60688489 GGGAGAAAGAGAACCAAGAGAGG - Intergenic
931647924 2:64442179-64442201 GGGGGACAGAGGAAATCTAGAGG - Intergenic
932003637 2:67906829-67906851 GGCTGACAGAGGAAAAACAGAGG + Intergenic
932246792 2:70203047-70203069 GGGAGCCACAGGACAAAAAGTGG + Intronic
934047085 2:88181171-88181193 GGGAGAGAGAGGAGAGAGAGAGG - Intronic
934047092 2:88181228-88181250 GGGAGAGAGAGGAGAGAGAGAGG - Intronic
934047105 2:88181339-88181361 GGGAGAGAGAGGAGAGAGAGAGG - Intronic
934047118 2:88181450-88181472 GGGAGAGAGAGGAGAGAGAGAGG - Intronic
934047127 2:88181507-88181529 GGGAGAGAGAGGAGAGAGAGAGG - Intronic
934104366 2:88682260-88682282 GGCAAACAGAGGAGAAAAAGGGG - Intergenic
936251115 2:110869187-110869209 GAGAGTGAGAGCACAAATAGGGG - Intronic
937380770 2:121374409-121374431 GGGAGACAGAGGAGAAATGTGGG + Intronic
938779995 2:134576164-134576186 GGGATACAGAGGAAGAATTGAGG + Intronic
940381882 2:153024627-153024649 GGGAGACGGAGGAAACTTAGGGG - Intergenic
941655343 2:168137867-168137889 GAGAGGCAGAGGAAAAATTGTGG - Intronic
942188951 2:173452131-173452153 AGGAGACAAAGGATAAAGAGTGG - Intergenic
943556039 2:189404920-189404942 TGGAGACACAGTACAAATATTGG + Intergenic
943807164 2:192136666-192136688 GGGAGATGGAGGAGAAAGAGAGG - Intronic
943824057 2:192365674-192365696 AAGAGAAAGAAGACAAATAGTGG + Intergenic
945497427 2:210526022-210526044 GGGAGGCAGAGGACAAAGTGTGG + Intronic
945772441 2:214061079-214061101 GTGAGACAGAGTACTAAGAGAGG + Intronic
946511694 2:220365011-220365033 GGAAGAGAGAGGAGAAACAGAGG - Intergenic
946841378 2:223823584-223823606 GGGGGACAGAGAAGAAATTGAGG + Intronic
947747599 2:232517000-232517022 GGGAGGAAGAGGAGAACTAGGGG + Intergenic
947996623 2:234533502-234533524 GAGAGAAAGAGGAAAAAAAGAGG + Intergenic
948267173 2:236643461-236643483 GTTGGACAGAGGACAACTAGAGG - Intergenic
948630564 2:239299921-239299943 GGGAGACAGAGAAGGAAGAGGGG + Intronic
949049445 2:241889301-241889323 GGGAGGGAGAGGAAAAAGAGAGG - Intergenic
1168930474 20:1619355-1619377 GGGGAACAGAGGACAAAGTGAGG + Intronic
1168962688 20:1879898-1879920 GGGACTCAGAGGTCAATTAGGGG - Intergenic
1169564711 20:6841370-6841392 GAGAGAGAGAGGAAGAATAGAGG + Intergenic
1169596091 20:7200643-7200665 GGGAGACAGAAGTTAGATAGCGG - Intergenic
1170172400 20:13429992-13430014 GGGACTGAGGGGACAAATAGAGG + Intronic
1170334925 20:15259222-15259244 ATGAGACAGAGGAAAAACAGTGG + Intronic
1170497839 20:16944123-16944145 GGTAGAGAGAAGACAAATGGAGG - Intergenic
1172317196 20:33965086-33965108 GGGGGAAAGAGGAAAAATTGAGG - Intergenic
1172776635 20:37411292-37411314 AGGAGACAGAAGGCAAATACAGG - Intergenic
1173701631 20:45076934-45076956 GGAAAACAGAGGACAATTTGAGG + Exonic
1173905560 20:46626202-46626224 GGGAGAGAGAGGACAGACAGAGG - Intronic
1174691833 20:52514100-52514122 GGGAGACAGGGGACAAAGGATGG - Intergenic
1176365135 21:6028139-6028161 TGGAGCCAGAGAACAAATCGAGG - Intergenic
1177546919 21:22570243-22570265 GACAGACAGAGGACAGACAGAGG + Intergenic
1178391400 21:32201291-32201313 CCGAGACAGAGGATAAATAGAGG + Intergenic
1178678746 21:34653786-34653808 AGGAGACAGAGGTCAGAGAGGGG + Intergenic
1179215383 21:39362728-39362750 TGAAGACAGAAGATAAATAGGGG + Intergenic
1179241485 21:39597060-39597082 AGAAGACAGAGGACATAGAGTGG - Intronic
1179758383 21:43510406-43510428 TGGAGCCAGAGAACAAATCGAGG + Intergenic
1180300273 22:11031669-11031691 GAGAGACAGAGGAGAGAGAGCGG - Intergenic
1181960594 22:26619280-26619302 GAGAGACAGAGGTCAAGTTGGGG + Intergenic
1182019226 22:27066871-27066893 GGCAGATAGAGAACAAAGAGAGG - Intergenic
1182580242 22:31304124-31304146 GGGAAGAAGAGGACAAATATGGG + Intergenic
1183082297 22:35464234-35464256 GACAGACAGAGGACAAAGAAGGG + Intergenic
1183442871 22:37833122-37833144 GGGAGAAAGAGGACAGAGAGGGG + Intronic
1183461749 22:37955181-37955203 GGGAGAGAGAAGAGAAATAAGGG + Intronic
1185004907 22:48270098-48270120 GGGAGAGAGAGGAGAGAGAGGGG + Intergenic
1185028133 22:48427186-48427208 GGGAGAGGGAGGACAAGAAGGGG - Intergenic
1185226904 22:49658349-49658371 GGGAGGCAGAGGGCAAACATCGG + Intergenic
949151172 3:769154-769176 GAGAGACAGAGAATAAAGAGGGG + Intergenic
949284389 3:2383794-2383816 GGGAGACAGAGGGAGAAGAGAGG - Intronic
950394012 3:12719647-12719669 GAGAGACAGAGGAGAGAGAGAGG + Intergenic
950444465 3:13028345-13028367 GGGGGACAGCTGACAAACAGAGG - Intronic
951518182 3:23584953-23584975 GGGAGACAGAGGTGAGATAGAGG + Intronic
952405684 3:33002924-33002946 GGGAGAAAGAGAAGAAAAAGAGG + Intronic
953605441 3:44410437-44410459 GGGAGACTGAGGACAAGTGAGGG - Intergenic
954702267 3:52456445-52456467 GGGAGACAGAGGACAAATAGCGG + Intronic
954753892 3:52828585-52828607 GGGTGGCAGAGGACAAAGTGAGG + Intronic
954765300 3:52910203-52910225 GGGAGACAGATAACAAACAAGGG - Intronic
955970158 3:64431022-64431044 GAGATACAGAGGACTACTAGAGG + Intronic
956074055 3:65486114-65486136 GGGACACAGAGATAAAATAGGGG - Intronic
956220622 3:66898774-66898796 GGGAGAAAGAGTACAAAGAGAGG - Intergenic
956353005 3:68358988-68359010 GTGAGACCCAGGACAAAAAGTGG - Intronic
957176693 3:76819886-76819908 GGGAGAATGAGGATAAATACTGG + Intronic
957480416 3:80785657-80785679 GGGAGACACAGCCCAAAAAGTGG + Intergenic
957623892 3:82632849-82632871 GGGAACTAGAGTACAAATAGGGG - Intergenic
957943567 3:87035627-87035649 TGGAGACAGAAGACGAATTGAGG - Intergenic
958439394 3:94137396-94137418 GGGAGAAAGAAAAAAAATAGTGG + Intergenic
959220000 3:103506432-103506454 AGGAGAAAGAGTACAAAGAGAGG + Intergenic
959935169 3:112021657-112021679 GGGAGCCAGAGGAAGAGTAGTGG - Intergenic
960758677 3:121048949-121048971 GGGATTGAGAGGACATATAGTGG - Intronic
960803722 3:121563171-121563193 GGGTAAAAGAGGAGAAATAGAGG + Intergenic
962489494 3:135878885-135878907 GTGAAACAGAGGACAAGTGGAGG + Intergenic
963093684 3:141511887-141511909 GGGATAGAGAGCACAAGTAGAGG + Intronic
963259468 3:143177914-143177936 GAAAGACAGAGGAGAAAAAGGGG - Intergenic
963462057 3:145627159-145627181 GGGAGAAAAAGGCAAAATAGTGG + Intergenic
963972679 3:151446928-151446950 GGGAGGCAGAGGAAAATTGGCGG - Exonic
963993499 3:151680241-151680263 TGGAGACAGAAGACAACAAGGGG - Intergenic
964025258 3:152065672-152065694 GGGAGGCAGAGGGCCTATAGTGG - Intergenic
965957982 3:174394695-174394717 GAGAGACAGAGGAAAGAGAGTGG + Intergenic
966003128 3:174974810-174974832 GGGAGAGAGAGGCAAAATATTGG + Intronic
967154815 3:186682670-186682692 GGGAGTAGGAGGACAAAGAGTGG + Intergenic
967390503 3:188949548-188949570 GGCAGAGATAGGCCAAATAGAGG - Intronic
967405302 3:189109138-189109160 GGGAGACAGAGCAGAGAGAGAGG + Intronic
967617882 3:191594963-191594985 TGGAGACAGAGGTCTAAAAGAGG + Intergenic
967685389 3:192410287-192410309 GAGAGACAGAAGACACAGAGAGG - Intronic
967785607 3:193490799-193490821 GGAAGCCAGAGGACAGCTAGAGG + Intronic
967811457 3:193764708-193764730 GGGGCACAGAGGAGGAATAGAGG + Intergenic
968391406 4:196042-196064 GAGAGAGAGAGGAAAAAGAGAGG - Intergenic
968519084 4:1027686-1027708 GGAGGACAGAGAACAAAAAGGGG - Intergenic
968957363 4:3726135-3726157 GGGAGGGAGAGGACAGAAAGAGG + Intergenic
969540192 4:7783984-7784006 GGGTGACACAGGGCAAATGGAGG + Intronic
969706252 4:8793907-8793929 GATTGGCAGAGGACAAATAGGGG + Intergenic
970374422 4:15442301-15442323 GGGAGACAGAGGAGAACAAGGGG + Exonic
970672391 4:18411930-18411952 GAGAGACAGAGAAGTAATAGGGG - Intergenic
971364189 4:25963976-25963998 GAGAGACAGAGGAGAAAAAAGGG - Intergenic
972595401 4:40525643-40525665 GGGAAAAAAAGGATAAATAGGGG + Intronic
972615491 4:40694241-40694263 GGGAGACAGAGGCCCACTGGAGG + Intergenic
973046284 4:45537392-45537414 GGGAGTCTGAGGACACATAAGGG + Intergenic
973256943 4:48123316-48123338 GTAAGACAGAGGCCAAATTGGGG - Intronic
975175855 4:71288377-71288399 AGGAGTCAGAGAACAAATATAGG + Intronic
975394102 4:73854914-73854936 CAGAGACAGAGGAGAAGTAGAGG - Intergenic
975469643 4:74750640-74750662 AGGAGACAGAGGACAGATTCTGG - Exonic
977539113 4:98293883-98293905 GGGAGAGAGAGGAGAAACAGAGG + Intronic
979201680 4:117986183-117986205 GGGAGAGATTGAACAAATAGGGG + Intergenic
979617333 4:122758521-122758543 GGGAGAAATATGACAAATAATGG + Intergenic
981655058 4:147103625-147103647 GGCAGACTGAGGACAGAAAGTGG - Intergenic
981746792 4:148059995-148060017 GGGAGAGAGAGGAGAGAGAGAGG + Intronic
982106516 4:152016161-152016183 GCGAGACAGAGAGAAAATAGGGG - Intergenic
982230919 4:153207295-153207317 GGGGGACAGACGACACACAGAGG + Intronic
982368220 4:154603948-154603970 AGGAGATACAGGACAAATACAGG - Intergenic
982753165 4:159187303-159187325 GAGAGACAGAGAAAAAAAAGGGG - Intronic
982823871 4:159977874-159977896 GAGAGAGAGAGGAAAAAGAGAGG + Intergenic
983445315 4:167843141-167843163 GGGAGGCAGAGGACACAGTGAGG + Intergenic
983786222 4:171732929-171732951 GGCAGAAAGAGGACTAAAAGTGG + Intergenic
984274593 4:177594706-177594728 ATGTGACAGAGGACAAACAGGGG - Intergenic
984443012 4:179797262-179797284 AGGAAACAGAGGAGAAAAAGAGG + Intergenic
985694201 5:1330847-1330869 TGGAGCCACAGGACAAACAGTGG + Intronic
986193396 5:5516840-5516862 GGGAGAAGGAGGAGAAATGGAGG - Intergenic
986604957 5:9513501-9513523 GGAAGACAGAGGGAAAAGAGAGG + Intronic
986897336 5:12385725-12385747 GGGACACAGAGAACAGAGAGGGG - Intergenic
987220135 5:15782854-15782876 AGGAGAAAGGGCACAAATAGTGG + Intronic
988527771 5:32001528-32001550 GGGAGACAGGGGACAGACACTGG - Intronic
990810179 5:59714424-59714446 GGGGGACACCAGACAAATAGAGG + Intronic
991404979 5:66293029-66293051 GGGAGGCAGTGGACAGAGAGTGG + Intergenic
991962300 5:72057258-72057280 GTGAAAAAGAGGACAAATATTGG + Intergenic
992497221 5:77305621-77305643 GGAAGCCAGAGGACAGACAGGGG + Intronic
992534456 5:77684969-77684991 GGGAGAAAGAGGATAAATGTAGG - Intergenic
992688634 5:79221983-79222005 GGGAGAGAGAGGCCATATGGAGG + Intronic
993856089 5:93077196-93077218 AGGAGAAAGAGAACATATAGAGG + Intergenic
994037923 5:95224042-95224064 GGGAAATACAGTACAAATAGGGG + Intronic
994153507 5:96475920-96475942 GGGAGCCAGAGGACAGTCAGTGG + Intergenic
994608547 5:102004952-102004974 GGGAGACTGGGAAAAAATAGAGG - Intergenic
996988308 5:129595717-129595739 GGGAAATAGAGAACATATAGTGG + Intronic
997549416 5:134738800-134738822 GGGAGACTGAGGGGAAATCGAGG - Intronic
997581648 5:135020902-135020924 GGGACACAGGGGACAGATACAGG + Intergenic
997597858 5:135119109-135119131 AGGAGACAGAGGAGACACAGGGG - Intronic
998165133 5:139838477-139838499 GGGAGAGGGAGGACACATGGGGG - Intronic
998526885 5:142850694-142850716 GGTAGAAATAGGACTAATAGAGG - Intronic
999997700 5:157107843-157107865 GGGGGGCAGAGGAAAAATATGGG - Intronic
1000169972 5:158692667-158692689 GGGAGACAGAGGGAAAATAGAGG - Intergenic
1000759677 5:165206811-165206833 TGGAGACGGAGAACAAAGAGGGG + Intergenic
1001816445 5:174673216-174673238 GGGGGGCAGAGGGCAAATGGTGG - Intergenic
1002089278 5:176794907-176794929 TGGAGACAGATGACAAACACAGG - Intergenic
1002388605 5:178891255-178891277 GGGAGAGAGAGAAGAAAAAGTGG + Intergenic
1003451705 6:6240465-6240487 GACAGACAGAGGACAAATCCAGG + Intronic
1003481572 6:6538453-6538475 AGGAGAGAGAGGAGAAAGAGAGG - Intergenic
1003987482 6:11451747-11451769 GGGAGACAGAGGAGAGATAAAGG + Intergenic
1004133046 6:12939434-12939456 GGGAGACAGAGTACAAACCAGGG - Intronic
1005228436 6:23671207-23671229 GGGAGAAACAGGTCAAATAAAGG + Intergenic
1005468846 6:26142056-26142078 GAGAGATAGTGGACAAATAATGG - Intergenic
1005850078 6:29814492-29814514 GGGAGACAGGGGCCATATGGTGG + Intergenic
1006186806 6:32186068-32186090 GAAAGACAGAGGAGAAAAAGGGG + Exonic
1007120151 6:39373055-39373077 AGGAAAAAGAGGACAGATAGAGG + Intronic
1007138898 6:39551351-39551373 GGGAGAGAGAGGATAAAGAGAGG + Intronic
1007368626 6:41411984-41412006 GGGAAACTGAGGCCAAAGAGAGG + Intergenic
1007394694 6:41570734-41570756 GGGATACAGAGGAGAATTTGGGG + Intronic
1007622057 6:43221342-43221364 GGGAGCCAGAGGGCAAGGAGGGG + Intronic
1007709109 6:43810458-43810480 GGGACACAGAGGACAAAGAAAGG - Intergenic
1008395413 6:51000873-51000895 GAGGGACAAAGGAAAAATAGTGG - Intergenic
1008725975 6:54419786-54419808 GGAAGACAGGGGAGAAAAAGAGG - Intergenic
1009451957 6:63811727-63811749 GGGGGAAAGAATACAAATAGTGG - Intronic
1010661571 6:78577465-78577487 GGCAGACAGAAGTCAAATAAAGG + Intergenic
1011417445 6:87137327-87137349 AGGAGAAAGAGGAGAAAGAGGGG - Intergenic
1012230214 6:96752094-96752116 GGGAGACACAGGACACAGTGAGG - Intergenic
1013286198 6:108683889-108683911 GGGAGGCAGAGTACTACTAGAGG + Exonic
1013344995 6:109251412-109251434 GGGAGAGAGAGTACAGAAAGTGG - Intergenic
1013704866 6:112820288-112820310 GGGAGGAAGAGGAAAAATATTGG + Intergenic
1014039200 6:116804856-116804878 TGGAGACAGATGACATAAAGTGG - Intronic
1014508859 6:122295154-122295176 GGAATACAGAGCAAAAATAGAGG + Intergenic
1017582745 6:155884366-155884388 GGGAGTCAGAGTGCAAACAGTGG - Intergenic
1018016286 6:159715176-159715198 GGGTGGCAGAGGACCAATTGGGG + Intronic
1018054263 6:160038141-160038163 GAGAGACTGAGGACACAAAGTGG + Intronic
1020171867 7:5851294-5851316 GGAAGAGAGAGGACAGAGAGAGG - Intergenic
1020499751 7:8902757-8902779 GGGACACAGAGGACAAGTCAGGG - Intergenic
1021041580 7:15869373-15869395 GAGGGACAGAGGAGAAAGAGAGG + Intergenic
1021131175 7:16914491-16914513 GGGAGGCAGAGGATAAAGAGGGG - Intergenic
1022418291 7:30197121-30197143 GGGAGAAATAGGACTATTAGAGG + Intergenic
1023798874 7:43815565-43815587 TGGAGAGAGAGGGCAAAGAGAGG + Intergenic
1024042116 7:45563940-45563962 TGGAGACAGAGGGCAACTGGTGG + Intergenic
1024574953 7:50755714-50755736 GGGAGAGAGAGGACAGAGACGGG + Intronic
1024871233 7:53963579-53963601 GGGAGAAAGAGAAGATATAGAGG + Intergenic
1025093132 7:56079328-56079350 GGGAGAAAGGGGACAAGAAGGGG - Intronic
1025775539 7:64557811-64557833 CGGAGGCGGAGGACAAAGAGAGG + Intronic
1025788706 7:64667679-64667701 GGGAGACAGAGGACAATCTGAGG + Intronic
1025802090 7:64795923-64795945 GGGAGACAGAGGACAACCTGAGG + Intronic
1025921514 7:65917403-65917425 GGTAGACAGAAGACAAATCATGG - Intronic
1029086811 7:98018268-98018290 GGAAGAGAGAGGACAGAGAGGGG + Intergenic
1029496584 7:100898243-100898265 GGGAGACAGAGATAAAAGAGGGG - Intergenic
1031438055 7:121757189-121757211 AGGATAAAGAGCACAAATAGTGG + Intergenic
1032402039 7:131630263-131630285 GGGACACAGAGGTCGAACAGGGG + Intergenic
1032806404 7:135359169-135359191 GGGAGAAAGATTACATATAGAGG + Intergenic
1033070578 7:138198181-138198203 GGAAGACAGAAGAGAAAGAGAGG + Intergenic
1034318449 7:150156561-150156583 GAGAGAGAGAGGAGAAAGAGAGG + Intergenic
1036022624 8:4862902-4862924 GGGAGACACAGCACCAAGAGAGG + Intronic
1036518766 8:9470745-9470767 GAGAGACAGAAGAGAAAGAGAGG + Intergenic
1036586586 8:10129864-10129886 GAGAGAGAGAGGAGAAATATGGG - Intronic
1037877049 8:22553488-22553510 GGGTGCAAGAGGACAAAAAGGGG - Intronic
1038764070 8:30411316-30411338 GGGAGACAGAGGACGGAGGGTGG + Intronic
1041393481 8:57368475-57368497 GGGAGAATGAGGAGAAATAAAGG - Intergenic
1041746184 8:61211453-61211475 GGGAGGCAGAGGAAAAGGAGAGG - Intronic
1042508218 8:69583954-69583976 GGGAACCAGAGAGCAAATAGAGG + Intronic
1043176265 8:77026660-77026682 GAGAGAGAGAGGACAAATGATGG + Intergenic
1044296627 8:90535338-90535360 GTGAGACAGAGGGAAAAAAGTGG + Intergenic
1044322638 8:90821594-90821616 GAGACACAGATGAAAAATAGGGG - Intronic
1044641183 8:94383357-94383379 GGAAGACAGAGGACTCACAGAGG + Intronic
1044857705 8:96493694-96493716 GGGAGCCAGAGGAAAAGAAGAGG + Exonic
1045158339 8:99505494-99505516 GGGAGAAAGATGGGAAATAGTGG + Intronic
1045805175 8:106150780-106150802 GGGAGAGAGATGAAAAAAAGGGG + Intergenic
1046130480 8:109961784-109961806 GGGAGAAGGAGGACAATTGGCGG - Intergenic
1046412641 8:113867292-113867314 GGGAGCCAGATGGCAGATAGGGG - Intergenic
1046598221 8:116286501-116286523 GGGAGCCAGAGTACAAATGTGGG - Intergenic
1047207707 8:122817014-122817036 TGGAGAAAGAGAACAAAAAGTGG + Intronic
1047430432 8:124786435-124786457 AGGAGACAGATGATAACTAGGGG - Intergenic
1050529359 9:6574867-6574889 GGGAGGGAGACGGCAAATAGTGG + Intronic
1050764657 9:9117020-9117042 GGGAGAAACAGGACAGATACAGG + Intronic
1051903744 9:22070978-22071000 GGGACACAGTGGACCAATGGGGG + Intergenic
1051915250 9:22200045-22200067 AGGAGACAGAGAACAAAGTGGGG - Intergenic
1052372807 9:27684940-27684962 GGGAAACAGAACACAGATAGGGG - Intergenic
1052843447 9:33313509-33313531 GGGAGACATAGGAAAAAGTGAGG + Intronic
1052946922 9:34176101-34176123 GGGAGAAAGAAGACAGAAAGAGG + Intergenic
1053350166 9:37408863-37408885 GGGAGTCAGAGAACAAAAATCGG + Intergenic
1055360631 9:75486376-75486398 AGGAAACAGAGGACCAAGAGAGG + Intergenic
1055366067 9:75546358-75546380 GGGAGACAAAGGGCAAAGATGGG - Intergenic
1056126705 9:83541666-83541688 GGCTGGCAGAAGACAAATAGTGG + Intergenic
1057218727 9:93244286-93244308 GAGAGACAGAGATGAAATAGCGG + Intronic
1058873524 9:109222674-109222696 GGGTGACAGAGGACAGATGTAGG + Intronic
1059172044 9:112134585-112134607 CAGACATAGAGGACAAATAGAGG + Intronic
1060047009 9:120349244-120349266 GTCAGACAGAGGACAAAGAGAGG + Intergenic
1061265374 9:129501756-129501778 GGGAGACAGAGGCCAATGTGTGG + Intergenic
1062151034 9:135019138-135019160 GGGAGACAGATGAAGAGTAGGGG + Intergenic
1062512837 9:136916939-136916961 GGGAGACAGCGGCCAAGGAGTGG - Intronic
1185460805 X:332087-332109 GGGAGACAGAGGAGATGGAGAGG - Intergenic
1185708451 X:2282578-2282600 GGGAGAGAGAGAAGAAAGAGGGG + Intronic
1185709817 X:2294772-2294794 GAGAGAGAGAGGAAAAAGAGAGG + Intronic
1185709820 X:2294797-2294819 GAGAGAGAGAGGAAAAAGAGAGG + Intronic
1186246485 X:7621671-7621693 ACGAGAGAGAGGAGAAATAGAGG - Intergenic
1186510559 X:10126920-10126942 GGGATACTGAGGACAAACTGCGG - Intronic
1186890437 X:13954263-13954285 AGGACACAGAGGACAATAAGGGG - Intergenic
1187505431 X:19874959-19874981 GGGAGAGAGAGGAGAAAAAGAGG + Intronic
1187616686 X:21002472-21002494 GTGAGAGTGAGGACAAATAGAGG - Intergenic
1187758452 X:22552254-22552276 TGGAGACAGAAGTAAAATAGTGG + Intergenic
1189289097 X:39872752-39872774 GGGAGAAGGAGGACAAAGAAGGG - Intergenic
1189334442 X:40162165-40162187 AGGTGACACAGGACAGATAGAGG - Intronic
1192675535 X:73192157-73192179 AAGAGAAAGAGTACAAATAGAGG + Intergenic
1192774782 X:74232192-74232214 GGAAGACAGAGGACAACTATAGG + Intergenic
1195915124 X:109928180-109928202 GGGAGGCAGAGGAGAAAATGAGG + Intergenic
1196141419 X:112266960-112266982 GGGAGATAGTGCACAAATGGAGG - Intergenic
1196428857 X:115600882-115600904 TAGAGAGAGAGGAAAAATAGAGG + Intronic
1196597520 X:117562315-117562337 GAAAGAGAGAAGACAAATAGAGG + Intergenic
1196987803 X:121294153-121294175 GGGAGTCAGAGGACAATTACAGG + Intergenic
1198009284 X:132534273-132534295 AGGAGACAGAGAAAAAATAGTGG + Intergenic
1198636845 X:138711073-138711095 GCGAGACAGCGGACAAGCAGCGG - Exonic
1199924898 X:152451729-152451751 GGGAGACAGAGGGAAAAAGGAGG - Intergenic
1200366200 X:155667347-155667369 TGAAGATACAGGACAAATAGGGG + Intronic
1201567614 Y:15383353-15383375 GGGAGACATAGGACACACTGAGG + Intergenic