ID: 954702268

View in Genome Browser
Species Human (GRCh38)
Location 3:52456446-52456468
Sequence GGAGACAGAGGACAAATAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954702260_954702268 2 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702268 3:52456446-52456468 GGAGACAGAGGACAAATAGCGGG 0: 1
1: 0
2: 0
3: 31
4: 342
954702261_954702268 1 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702268 3:52456446-52456468 GGAGACAGAGGACAAATAGCGGG 0: 1
1: 0
2: 0
3: 31
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954702268 Original CRISPR GGAGACAGAGGACAAATAGC GGG Intronic
900818593 1:4869373-4869395 GGAGGCAGAGAAGAAATACCTGG + Intergenic
900864827 1:5260776-5260798 GGAGACAGGGGGCAAATGGACGG - Intergenic
901026870 1:6282993-6283015 GGAGTCACAGGCCAAAAAGCAGG + Intronic
904652452 1:32015473-32015495 GGAGACAGAGAACAAAGGGAGGG - Intronic
905002449 1:34683641-34683663 GGACACAGAGGAGGATTAGCTGG - Intergenic
906277457 1:44527334-44527356 GGTGAAAGAGGACAGATAACGGG - Intronic
906707441 1:47905080-47905102 GGAGACAGGGAACAAGTAACTGG + Intronic
907138866 1:52165942-52165964 TAAAACAGAGCACAAATAGCAGG - Intronic
907589989 1:55657263-55657285 GGTGACAGAGGACAGATCACTGG - Intergenic
907617426 1:55938834-55938856 GGACAGAGAAGACAAAGAGCAGG + Intergenic
907771197 1:57466065-57466087 GGAGACCAAGGACAAATGGCTGG - Intronic
908070089 1:60450890-60450912 GGAGACAGACAACGAATAGACGG + Intergenic
908850928 1:68375064-68375086 GGAGGTAGAGGATAAAAAGCTGG + Intergenic
910568933 1:88678776-88678798 GATGACAGAGGAAATATAGCAGG - Intergenic
911007870 1:93246117-93246139 GGAGATTGAAGACAAAAAGCAGG + Exonic
912224151 1:107712951-107712973 CGGGACAGAGGAAAAACAGCAGG + Intronic
912798275 1:112705886-112705908 GGAGGCAGAGGACAGAAACCCGG + Exonic
913027018 1:114854124-114854146 GGAGACAGAGGAGAGAAAGGAGG - Intergenic
913231078 1:116741180-116741202 GGAGAAAGAGGCCAAAGAGGAGG - Intergenic
913306471 1:117432179-117432201 GAAGACAGATTACCAATAGCAGG + Intronic
913306480 1:117432399-117432421 GAAGACAGATTACCAATAGCAGG + Intronic
913659553 1:120994277-120994299 GGAGACTGAGGAAAAATATTTGG + Intergenic
918414289 1:184290572-184290594 GGAGTCAGTGGACAAGTGGCAGG - Intergenic
918720209 1:187842759-187842781 GGAGTCAGTGGGCAAGTAGCAGG + Intergenic
919186864 1:194162174-194162196 GGAGGCAGAGAACACAAAGCAGG - Intergenic
921340790 1:214132306-214132328 GGAGGCAGAGAACAGAGAGCGGG - Intergenic
921790460 1:219284099-219284121 GGAGAGAGAGGAGAAAGAGCAGG - Intergenic
922178431 1:223215135-223215157 GGAGACAAAGGACACCTGGCTGG - Intergenic
922201154 1:223402569-223402591 AGAGACAGAGGAGAAATAGAGGG - Intergenic
922299724 1:224287227-224287249 GGAGACAGAGAGCAAATTGATGG + Intronic
922694166 1:227719691-227719713 AGAGACAGAGGAGAAAAAGAGGG - Intergenic
923594879 1:235353369-235353391 GGAGACAGAGGACTAGGAGGTGG + Intergenic
924121555 1:240804747-240804769 AGAGACACAGGACAGAGAGCAGG - Intronic
1064547157 10:16462536-16462558 GAAGACACAGCACAAATCGCAGG - Intronic
1065232705 10:23614841-23614863 GGAAATAGAGGATAAATAGAAGG + Intergenic
1065589750 10:27252432-27252454 GGAGTCTGAGGACAACTAGGAGG - Intergenic
1066092993 10:32044374-32044396 GAAGACAGAGGACACATGCCGGG + Intronic
1066753643 10:38686791-38686813 GGAGACAGAGACCAAATTGAAGG + Intergenic
1067030426 10:42875823-42875845 GGAGACAGGGGACACACAGCTGG - Intergenic
1067470633 10:46535508-46535530 GGAGAAAGAGGAGAAACAGGAGG - Intergenic
1067535809 10:47109080-47109102 GGAGACATAGGAGACAAAGCAGG - Intergenic
1068203901 10:53822453-53822475 GGAGAAGGAGGAGAAATAGGAGG + Exonic
1068325047 10:55474221-55474243 CCAGACAGAAGAGAAATAGCTGG + Intronic
1069165615 10:65154425-65154447 GGAGAGAGAGAAAATATAGCTGG + Intergenic
1069629389 10:69888632-69888654 GGGTACGGAGGTCAAATAGCTGG + Intronic
1069757961 10:70785340-70785362 GGAGCAAGAGGACAAATCGAGGG + Exonic
1069797628 10:71063411-71063433 GGAAACAGAGGACATAGAGCTGG + Intergenic
1069967012 10:72127923-72127945 GGAAAGAGAGGAAAAGTAGCTGG - Intronic
1070638562 10:78148917-78148939 GGAGACTGGGGACAGATAGCAGG + Intergenic
1072559940 10:96562845-96562867 GGGAACATTGGACAAATAGCTGG - Intronic
1073068828 10:100780779-100780801 GGAGACTGAGAACAATGAGCTGG + Intronic
1074567207 10:114590902-114590924 GGAGGCAGAGGACAAAAGGAGGG - Intronic
1075074954 10:119344592-119344614 GGAAAGAGAGGACAGACAGCAGG - Intronic
1076024577 10:127101019-127101041 AGAGAGAGAGGACAAAGGGCAGG + Intronic
1077362895 11:2148538-2148560 GGAGACTGAGGAGAAATGCCGGG - Intronic
1077440014 11:2563788-2563810 GAAGACAGAAAACAAATAGCAGG - Intronic
1077856601 11:6132546-6132568 AGAAACAGAGAACAAAAAGCAGG + Intergenic
1078002044 11:7504833-7504855 GGAGTCAGAGGACAAGAAACAGG - Intronic
1079045356 11:17097591-17097613 GGAGAAAGATGACAAATAGGTGG + Intronic
1079666832 11:23116715-23116737 GGAGACAGAGGTAAAATCTCTGG - Intergenic
1080570022 11:33547325-33547347 GGAGACAAAGGACAGAGAACAGG - Intronic
1083405900 11:62456863-62456885 GCTGACAAAGGACAAAGAGCTGG - Intronic
1084773372 11:71358511-71358533 GGAGACAGAGGACACAAGGATGG - Intergenic
1086953321 11:92912529-92912551 GGAGACAGAAGGCAAATATCAGG - Intergenic
1090459354 11:126876424-126876446 GGAGAAAGAAGCCACATAGCTGG + Intronic
1090468915 11:126961074-126961096 GGAGAAAGATGAGAAATGGCTGG - Intronic
1091394157 12:143319-143341 GGTGAGATAGGAGAAATAGCTGG + Intronic
1092004367 12:5056699-5056721 GGAGGGAGAGGACAGAAAGCTGG + Intergenic
1092573629 12:9753971-9753993 GGAGCCATAGGACAAATATTAGG + Intronic
1093897545 12:24591845-24591867 GGAGACAGAGGAGAAAATGATGG + Intergenic
1094152334 12:27298730-27298752 GGAGACAGAGGCAAAAGAGCAGG + Intronic
1094247500 12:28316888-28316910 CGACACTGAGGACAAATTGCTGG - Intronic
1094637029 12:32236469-32236491 GGAGAAAGATGGGAAATAGCTGG - Intronic
1095910551 12:47422250-47422272 AGAGAGAGAGAGCAAATAGCTGG - Intergenic
1096778954 12:53981235-53981257 GGAGGCTGAGGACACTTAGCAGG - Intergenic
1098742347 12:74189712-74189734 GGAGACAGAAGAGAAAGAGAGGG - Intergenic
1099631610 12:85154682-85154704 GGAGTCAGAGAAGAAATATCAGG + Intronic
1101024148 12:100584342-100584364 GGAGACAGAGAAGAAACAGTTGG - Intronic
1104479922 12:129098891-129098913 GGAGACAGAGGATTAAGAGAGGG - Intronic
1106875361 13:34066172-34066194 GGAGGAAGAGTACAAGTAGCTGG + Intergenic
1107233678 13:38142562-38142584 GGTGACAGAGGAAAAAGAGGTGG - Intergenic
1107492608 13:40895585-40895607 GGAGACAGAAATCCAATAGCTGG + Intergenic
1107533288 13:41305063-41305085 GAAAACAGATGAGAAATAGCTGG - Intergenic
1107773724 13:43815442-43815464 GGAGAGAGAGGACTGATAGCAGG - Intergenic
1108000877 13:45904660-45904682 GGAGGCAGAGGTCAAAGGGCAGG + Intergenic
1109358024 13:61257662-61257684 GGAGACAGAGGATGAATATGTGG - Intergenic
1110791917 13:79594989-79595011 GAAAACAGAGGACTAGTAGCTGG - Intergenic
1111760413 13:92457010-92457032 AGACACAGAGGACAACTAGATGG - Intronic
1112367802 13:98770615-98770637 GGGGACAGAGGACAACTATTAGG + Intergenic
1112783417 13:102926455-102926477 GGAGACAGGGGACAGGCAGCAGG + Intergenic
1113640442 13:111953370-111953392 GGAGAGGGAGGACACATAGTGGG + Intergenic
1114830766 14:26138871-26138893 AGAGACAGAAGAGAAAGAGCAGG + Intergenic
1117803547 14:59467687-59467709 GGAGAGAGATGCCAAGTAGCAGG - Intronic
1118856728 14:69629079-69629101 GGAGGCAGAGAACAAATGCCTGG + Intronic
1120664948 14:87294856-87294878 GGGTCCAGAGGACAGATAGCGGG + Intergenic
1122895650 14:104755510-104755532 GGAGACAGAGGGCACACAGGAGG + Intronic
1122988097 14:105221852-105221874 GGACACAGAGGACGAGGAGCTGG - Exonic
1123680418 15:22758703-22758725 AGAGACAGAGAACAAAAAGATGG - Intergenic
1124332633 15:28833166-28833188 AGAGACAGAGAACAAAAAGATGG - Intergenic
1124995640 15:34720734-34720756 GGAGACTGAGTCCAAACAGCAGG - Intergenic
1127148256 15:56047991-56048013 GGAGGCAGATGAAGAATAGCTGG + Intergenic
1128603586 15:69017862-69017884 AGAAACAGAGGTCAAATAACTGG + Intronic
1128689789 15:69714897-69714919 TGAGACAGAGAACTAAAAGCAGG - Intergenic
1129867545 15:78921196-78921218 TGAGCCATAGGACAAAGAGCTGG + Exonic
1130609774 15:85350509-85350531 GGACACAGATGATAAATTGCTGG + Intergenic
1131188930 15:90298270-90298292 TGAGAAAGAGAACAAATATCTGG - Intronic
1133272421 16:4616703-4616725 GGCGACAGAAGAGCAATAGCCGG + Intronic
1134840933 16:17400942-17400964 AGAGACAGAGGAGAGAGAGCTGG - Intronic
1136729092 16:32390405-32390427 GGAGACAGAGACCAAATTGAAGG - Intergenic
1137235768 16:46616367-46616389 GGTGACAGAGAATAACTAGCAGG + Intronic
1137912499 16:52392259-52392281 GGAGAAAGAGGACGAATCACAGG - Intergenic
1139316289 16:66072193-66072215 GGAGACAAAGGACAGCTAGTAGG + Intergenic
1139642160 16:68299523-68299545 GGAGACAGACAACAAAGAGCTGG - Exonic
1139910139 16:70392616-70392638 GGGCTCAGAGGACAAATAGGAGG + Intronic
1202997308 16_KI270728v1_random:127114-127136 GGAGACAGAGACCAAATTGAAGG + Intergenic
1203023995 16_KI270728v1_random:439456-439478 GGAGACAGAGACCAAATTGAAGG + Intergenic
1142959334 17:3542851-3542873 GGAGACGGAGGAGAAACAGCTGG - Intronic
1143015796 17:3890547-3890569 GGAGACAGAGGAGGACGAGCAGG - Intronic
1143180136 17:4979631-4979653 GGAGTCAGAAGACAAATAGGAGG + Intronic
1143567655 17:7734256-7734278 GGTGATAAAGGACAAAGAGCTGG + Exonic
1143684034 17:8499419-8499441 GGAGACAGATAACAAGGAGCTGG - Exonic
1144042530 17:11425471-11425493 GGAGGCAGAGGAACAAAAGCTGG - Intronic
1146339709 17:32008005-32008027 GGAGTCTGAGGACAACTAGGAGG + Intronic
1147794657 17:43033847-43033869 GAAGACAGAAGACAGAAAGCAGG + Intergenic
1150624717 17:66834583-66834605 GGAGTCTGAGGACACACAGCTGG - Intergenic
1152132452 17:78485373-78485395 GGAGACAGAGGAGGAGCAGCCGG - Intronic
1152874773 17:82780324-82780346 GGAGAGAAACGACAAACAGCTGG - Intronic
1153591410 18:6677361-6677383 AGAAAGAGAGGAGAAATAGCAGG + Intergenic
1155100797 18:22608016-22608038 GGTGACAGAGGTCAAATTGCTGG - Intergenic
1155421805 18:25664526-25664548 GGAGGCAGAGGTTAAATATCAGG + Intergenic
1155860782 18:30896394-30896416 GGAAAAAGAGAACAAATAGAAGG - Intergenic
1157097520 18:44699845-44699867 GGAGACAGAAGACAAACGTCTGG + Intronic
1157749714 18:50167616-50167638 TGGGTTAGAGGACAAATAGCTGG - Intronic
1158379242 18:56910520-56910542 GGAGAAAAATCACAAATAGCAGG - Intronic
1159740201 18:72158066-72158088 TGAGACAGAGGAGAAATGACAGG + Intergenic
1160039268 18:75331202-75331224 GGAGGCAGAGGAGAAATAAAAGG - Intergenic
1160271311 18:77386828-77386850 GGAGACAGTGGCCAAACATCAGG - Intergenic
1161104863 19:2438292-2438314 GGAGACACAGGACAGCGAGCTGG + Intronic
1161578444 19:5067569-5067591 AGAGTCAGAGGACAGAGAGCTGG + Intronic
1161782553 19:6302927-6302949 GGAGCCAGAGGACAGATACTGGG + Intergenic
1163319066 19:16561772-16561794 GGAGACACAAGACAAAGAGGGGG + Intronic
1163472319 19:17504817-17504839 GGAGACAGAGGCTGAAAAGCAGG - Exonic
1164324768 19:24181442-24181464 GGAGACAGAGGAGAAAAAGGGGG + Intergenic
1165424761 19:35739740-35739762 GGAGACAGGGGACACATGGAAGG - Exonic
1165594934 19:37005067-37005089 GCAGACACAGGGCAAAGAGCAGG - Intergenic
1167191234 19:47991571-47991593 GGAGACAGAGGGGAAAGAGAGGG - Intronic
1167640287 19:50678051-50678073 GGACACATACGAAAAATAGCAGG - Intronic
1167747226 19:51359022-51359044 GGAGAAAGAGGAGAAGGAGCTGG + Intronic
925656963 2:6159467-6159489 AGAGACAGAGGAAAATAAGCAGG - Intergenic
926194421 2:10753954-10753976 GGAGAGAGAAGAAAAAGAGCCGG - Intronic
926259571 2:11246082-11246104 AGACACTGAGCACAAATAGCTGG + Intronic
928859163 2:35834938-35834960 AGAGAAAGAGGGAAAATAGCAGG + Intergenic
929382125 2:41365501-41365523 GGAGACAGAGAACAAATTCGGGG + Intergenic
929441028 2:41965902-41965924 GGAGACAGAGGAGAGAGAGTGGG + Intergenic
930421345 2:51156950-51156972 GGAGACAGAGGAAATATAGTGGG + Intergenic
931194919 2:60042336-60042358 GGAGACAGAGGACCCACACCGGG - Intergenic
931336714 2:61352782-61352804 GGAGGAAGAGGACAAAGAGGAGG + Intronic
931757690 2:65388652-65388674 GCAGACAAAGGACCAAAAGCAGG + Intronic
932839838 2:75071938-75071960 GGAGACAAAAGCCAGATAGCAGG + Intronic
933378444 2:81512138-81512160 GAAGACAGAGGAGAAATAGAAGG + Intergenic
933551299 2:83780299-83780321 GGAGACAGAGTAAAGATAGATGG - Intergenic
934185377 2:89668308-89668330 GGAGACAGAGACCAAATTGAAGG - Intergenic
934317026 2:91932099-91932121 GGAGACAGAGACCAAATTGAAGG + Intergenic
934718106 2:96554804-96554826 AGAGACTGAGGACAAGTACCAGG + Intergenic
937169253 2:119849220-119849242 AGAAACAGAAGAAAAATAGCAGG - Intronic
937315490 2:120929664-120929686 GGACACAGAGGACAACTGGAAGG - Intronic
937380771 2:121374410-121374432 GGAGACAGAGGAGAAATGTGGGG + Intronic
939459015 2:142475435-142475457 AGAGAAAGAGGACAGATAGAAGG - Intergenic
941731057 2:168918352-168918374 TCACACAGAGGACAAATGGCTGG + Intergenic
941754365 2:169168739-169168761 AGAGCCAAAGGAGAAATAGCAGG - Intronic
942106995 2:172642895-172642917 GGAGAAAGAGGAGAAAAAGAAGG - Intergenic
943806219 2:192130285-192130307 GGAGACAGAGGAGAAGGAGGAGG - Intronic
943829251 2:192438197-192438219 GGATTAAGAGGACAAATAACAGG + Intergenic
944541241 2:200755739-200755761 AAAGACAGAGGACAAAGAACTGG + Intergenic
945504117 2:210616677-210616699 GTAGCCAGAAGACAAATGGCAGG + Intronic
947207020 2:227670463-227670485 GGACACAGAGGAAAAATAGATGG - Intergenic
947229435 2:227870454-227870476 GAAGACCGAGGACGAATTGCAGG + Intergenic
948088115 2:235267477-235267499 GAAGACACAGGAAATATAGCTGG - Intergenic
948458423 2:238117965-238117987 GTGGACAGAGGAGAAATAGATGG + Intronic
1169389009 20:5174350-5174372 GGAGGCACAGGTCAAACAGCTGG - Intronic
1169948739 20:11018340-11018362 GTAGAAAGAAGACAAATAACTGG + Intergenic
1170319087 20:15074655-15074677 TGAGTTAGAGGACACATAGCTGG + Intronic
1170334926 20:15259223-15259245 TGAGACAGAGGAAAAACAGTGGG + Intronic
1170798599 20:19571455-19571477 GGAGAGAGAGGAGAAAAAGAAGG + Intronic
1170921713 20:20685678-20685700 AGAGCCAGAGGAGAAAGAGCAGG + Intronic
1171283897 20:23922369-23922391 GGAGACAAAGGAAAAAGAGGAGG - Intergenic
1171322495 20:24258656-24258678 GGACACAGAGAACAAATGCCAGG - Intergenic
1173905559 20:46626201-46626223 GGAGAGAGAGGACAGACAGAGGG - Intronic
1174163294 20:48566858-48566880 GAAGACACAGGACAAAAAGAAGG - Intergenic
1174427497 20:50442799-50442821 GAAGACAGAGGTGAAATACCAGG - Intergenic
1175176629 20:57116256-57116278 GGCGACAGAGGAGACATGGCTGG - Intergenic
1175319327 20:58074334-58074356 GGAGACAAAGGACAAATGAAAGG + Intergenic
1175452064 20:59077780-59077802 GGAGAAGGAGGACAAAGAGGAGG + Intergenic
1175508368 20:59503733-59503755 GGGGACAGAGGAAAACTACCAGG - Intergenic
1176407366 21:6428448-6428470 GGACACAGAGGACCATTAACAGG + Intergenic
1177310731 21:19388868-19388890 GGAGACAGAGGAGAAAAAAAAGG + Intergenic
1177754257 21:25325703-25325725 AGTGACAGAAGACACATAGCTGG + Intergenic
1178762782 21:35419893-35419915 GTAGACAGATGACAGATAGATGG + Intronic
1179120928 21:38544968-38544990 GGAGAAAGAAGACCAAGAGCGGG - Intronic
1179132280 21:38648749-38648771 CCAGACAGAGGACAGAAAGCAGG + Intronic
1179295507 21:40058474-40058496 GGAGACACAGGAAACAGAGCAGG - Intronic
1179682874 21:43036851-43036873 GGACACAGAGGACCATTAACAGG + Intergenic
1180543384 22:16474613-16474635 GGAGACAGAGACCAAATTGAAGG + Intergenic
1182322726 22:29489062-29489084 GGAGAAAGAGGCCAAAGAGGAGG + Exonic
1183220886 22:36512293-36512315 GGAGACAAATGCCAAACAGCAGG - Intronic
1184485616 22:44777001-44777023 GGAGCCTGAGGGCAAAAAGCCGG - Intronic
1184675379 22:46039139-46039161 GGAGCCAGAGGCCACACAGCTGG - Intergenic
1185026910 22:48419628-48419650 GGTGACTGAGGACAAATGGCAGG - Intergenic
1185156330 22:49195547-49195569 GGGGACAGAGGATCAAGAGCCGG + Intergenic
1185226905 22:49658350-49658372 GGAGGCAGAGGGCAAACATCGGG + Intergenic
949284663 3:2387836-2387858 GAAGACAGAAAACAAAGAGCTGG + Intronic
950239856 3:11359161-11359183 GGAGAAAGAGGACAAGAAGAAGG + Intronic
950241689 3:11376190-11376212 GGAGAATGAGGACTAATTGCTGG + Intronic
951964980 3:28371995-28372017 GGAGAAAGAGGAGAAAGAGGAGG - Intronic
953470837 3:43164434-43164456 GGAAAGAGATAACAAATAGCTGG + Intergenic
954420730 3:50417732-50417754 GGTGCCAGAGGACAAGCAGCAGG - Intronic
954580274 3:51699513-51699535 GGAGACAGAGTGGAAATGGCGGG + Exonic
954702268 3:52456446-52456468 GGAGACAGAGGACAAATAGCGGG + Intronic
955673152 3:61423572-61423594 GGACACTCAGAACAAATAGCAGG + Intergenic
955810419 3:62782148-62782170 GGAGACAGAAAAGAAATACCAGG + Intronic
956746643 3:72316090-72316112 TGAGCCAGAGGAGCAATAGCTGG - Intergenic
958862543 3:99462471-99462493 GGAGATAGAGAATAAATAGGAGG + Intergenic
960415037 3:117374597-117374619 GGACACAGAGCACAAAGAGGTGG - Intergenic
960788803 3:121403449-121403471 GGAAACAAAGGAAAAATTGCTGG - Intronic
961183766 3:124896945-124896967 GGAGGCAGAGCACATATACCAGG + Intronic
964071224 3:152635508-152635530 GGGCAGAGAGGACAAATACCAGG - Intergenic
964117162 3:153148354-153148376 GGAGACAAAGGAGAAATAAAAGG - Intergenic
964497623 3:157310447-157310469 AGAGACAAAGGACACACAGCTGG + Intronic
965645610 3:170877952-170877974 TGAGACAGAGAACAAATAAGTGG - Intergenic
966277817 3:178196976-178196998 GTAGGCAGAACACAAATAGCTGG + Intergenic
966554287 3:181241922-181241944 GGAGACAGAGTAGAAAGGGCAGG - Intergenic
966891703 3:184411914-184411936 GGAGAAATAGGACCAATAGGAGG + Intronic
967295685 3:187962630-187962652 GGATACAGAGGACAAATGGAAGG + Intergenic
967617883 3:191594964-191594986 GGAGACAGAGGTCTAAAAGAGGG + Intergenic
969284438 4:6194101-6194123 GGAGACAGAGGGCAGATGGATGG + Intronic
970531348 4:16988639-16988661 GGAGACAGTGGAGGAAGAGCAGG + Intergenic
971516586 4:27494593-27494615 GGAGACAGAGAAAGAAAAGCAGG + Intergenic
972043852 4:34639258-34639280 GTAGACACAGGACGAAAAGCAGG + Intergenic
972615791 4:40696786-40696808 GGAGAAAGAGGACAATCAGAAGG + Intergenic
973284927 4:48404056-48404078 GGAGAAAGAGGAAAAGAAGCAGG - Intronic
975175856 4:71288378-71288400 GGAGTCAGAGAACAAATATAGGG + Intronic
975464823 4:74697552-74697574 GGAGGCAGTGCACAAACAGCTGG - Intergenic
976013425 4:80520079-80520101 GGAGACAGAGTGAAAAAAGCAGG + Intronic
976458939 4:85284882-85284904 GGATACAGAGGAGAAACTGCAGG - Intergenic
976863334 4:89692657-89692679 GGAGATAGAGAACAGATAGACGG + Intergenic
977097198 4:92761344-92761366 AGTGAAAGAGTACAAATAGCTGG - Intronic
977315616 4:95444197-95444219 GGAGAAAGAGGTCAATGAGCAGG - Intronic
977539114 4:98293884-98293906 GGAGAGAGAGGAGAAACAGAGGG + Intronic
977948920 4:102947176-102947198 GGAGACAGAGACCAAATTGAAGG + Intronic
978540118 4:109807606-109807628 GGACACAGTGGACAACTAGAAGG - Intergenic
979769290 4:124502842-124502864 GGAGAAAGAGGAAGAAAAGCAGG - Intergenic
981569802 4:146139418-146139440 GCAGATAAAGGACAAATGGCAGG - Intergenic
984179030 4:176457943-176457965 GAAGCCAGAGAACAAAAAGCAGG + Intergenic
984459245 4:180012055-180012077 GGAGACTGAGGACAATTGTCAGG - Intergenic
985380348 4:189388526-189388548 GGAGAAGTAGGAAAAATAGCTGG + Intergenic
986312329 5:6561246-6561268 GAAAACAGAGGAAAATTAGCTGG + Intergenic
986391412 5:7290683-7290705 GGAGACAGAGAACAAAAAGATGG - Intergenic
986416847 5:7537566-7537588 AGAGGCAGAGGATGAATAGCAGG - Intronic
990109991 5:52310793-52310815 GGAGAGAGAGGAGAGAGAGCAGG - Intergenic
990282259 5:54263880-54263902 TGAGACAGGGGACACATAGAAGG - Intronic
992349668 5:75916240-75916262 GGAGAAAGAGGACAAGGAGGAGG - Intergenic
992380300 5:76229666-76229688 GGAGAGAGAGGACATATATGTGG + Intronic
992381154 5:76239138-76239160 GCAGACAGAGGAAGAATAACTGG - Intronic
992417239 5:76563436-76563458 GTAGACAGATGATAAAAAGCTGG + Intronic
994322949 5:98414356-98414378 GGCTACAGAGGAAAAATAGATGG - Intergenic
994731694 5:103499221-103499243 TTAAAAAGAGGACAAATAGCAGG - Intergenic
994845925 5:104988231-104988253 AGAGACAGAGGACATAGAGGAGG + Intergenic
997123825 5:131205151-131205173 GGAGAGAGAGGAGAAAGAGAAGG - Exonic
997316622 5:132942050-132942072 GGAGACAGAGAACACCCAGCTGG - Intronic
998476236 5:142424329-142424351 AGAGAGAGAGAACAAAAAGCTGG - Intergenic
999275170 5:150325399-150325421 GGAGACAGAGGACAGGGGGCAGG + Intronic
999384367 5:151143934-151143956 GGAGACACATGACAAAGACCTGG + Intronic
1000774333 5:165399092-165399114 AGAGACAGAGGATAAAAACCAGG - Intergenic
1001189020 5:169609409-169609431 GGAGCAAGATGACAAATAGAAGG + Intergenic
1001227987 5:169962203-169962225 GGAGGCAGAGGACAGTTAGGAGG + Intronic
1001499986 5:172223872-172223894 AAAGACAGAGGACAAATACAAGG + Intronic
1002553234 5:180013876-180013898 TGAGACAGGGGACACACAGCTGG + Intronic
1003481571 6:6538452-6538474 GGAGAGAGAGGAGAAAGAGAGGG - Intergenic
1003593016 6:7451624-7451646 AGATACAGAGGACAAATTGGTGG + Intergenic
1003696541 6:8411395-8411417 GGAGACAGAGGTAAAATATTAGG + Intergenic
1003987483 6:11451748-11451770 GGAGACAGAGGAGAGATAAAGGG + Intergenic
1007120152 6:39373056-39373078 GGAAAAAGAGGACAGATAGAGGG + Intronic
1007709108 6:43810457-43810479 GGACACAGAGGACAAAGAAAGGG - Intergenic
1008666766 6:53724586-53724608 GGAGACAAAGGACAAAGGACAGG + Intergenic
1009889647 6:69665214-69665236 GGAGAAAGAGGAAAAATATTAGG + Intergenic
1010863613 6:80944415-80944437 GGATAGAGAAGAGAAATAGCAGG - Intergenic
1011345006 6:86359428-86359450 GGAGATTAAGAACAAATAGCTGG + Intergenic
1011417444 6:87137326-87137348 GGAGAAAGAGGAGAAAGAGGGGG - Intergenic
1014285281 6:119489965-119489987 GGAGACAGTGGAAAAAAACCTGG + Intergenic
1019740071 7:2668352-2668374 GGAGACAGAGGACCAAAGACTGG + Intergenic
1019852099 7:3569919-3569941 GGAGACAGAGGAAAAGGAGATGG - Intronic
1020610406 7:10389682-10389704 GGAGACTGAGGCAAAATTGCTGG - Intergenic
1022109965 7:27223143-27223165 GGAGAGAGAAGGCAAACAGCAGG + Intergenic
1022498808 7:30869831-30869853 GGAGACCGAGGCCACACAGCAGG + Intronic
1023214471 7:37847366-37847388 GGAGACAGAGGAGACAGAGGAGG + Intronic
1024153794 7:46599930-46599952 AGAGAGAGAGGAGAAAGAGCTGG + Intergenic
1025887784 7:65614561-65614583 GGAGAAAGAGGACAAAGAGGAGG - Intergenic
1026957538 7:74387152-74387174 GGACACAGAGAACACAGAGCTGG - Intronic
1027122305 7:75530608-75530630 GGAGAGACAGGAGAAATGGCAGG - Intergenic
1027354032 7:77339290-77339312 GGAAACAAATGAGAAATAGCAGG + Intronic
1027839700 7:83293258-83293280 GGATACAGAGGATGGATAGCTGG + Intergenic
1029406107 7:100374803-100374825 AGAGACACATGACAAAGAGCGGG - Intronic
1030763404 7:113379100-113379122 GAAGAAAGAGGACAAATGGAAGG + Intergenic
1031564122 7:123273559-123273581 AGAAACAGAGGACAAAAAGCAGG - Intergenic
1032152381 7:129440486-129440508 GGAGACAAAGGAAAAAGAGATGG - Intronic
1032626422 7:133596434-133596456 GGAAACAGAGGATAAAGAACGGG - Intronic
1032651358 7:133882341-133882363 GCAGAGAAAGGACAAAAAGCAGG - Intronic
1033295729 7:140132785-140132807 AAAGACTGAGGAGAAATAGCAGG + Intronic
1035334228 7:158115244-158115266 GGAGACAGAAGGGAAACAGCTGG + Intronic
1035489721 7:159263233-159263255 GGAGAAAGAGGAGAAAGAGAAGG + Intergenic
1036943503 8:13073008-13073030 AGAGAAAGAGGACACATCGCTGG + Intergenic
1038037516 8:23699096-23699118 GGAGACAGAAGACAGGCAGCTGG + Intergenic
1038432266 8:27509930-27509952 GGAAACTGAGGACACATGGCAGG + Intronic
1040097138 8:43456953-43456975 GGAGAAACAGGAGAAAAAGCTGG - Intergenic
1040557987 8:48498052-48498074 GGAGACACGGGACAAAGAGATGG - Intergenic
1042036001 8:64534360-64534382 GGAGAAAGAGGAGAAATTGATGG + Intergenic
1042692440 8:71516381-71516403 GGTGAGAGAGGACAACTAGTTGG + Intronic
1043200299 8:77361140-77361162 GGAAACAGAGGACAAAGAGGAGG + Intergenic
1046130479 8:109961783-109961805 GGAGAAGGAGGACAATTGGCGGG - Intergenic
1047207708 8:122817015-122817037 GGAGAAAGAGAACAAAAAGTGGG + Intronic
1047430431 8:124786434-124786456 GGAGACAGATGATAACTAGGGGG - Intergenic
1047918449 8:129608138-129608160 GGAAACAGGGAAGAAATAGCTGG - Intergenic
1048056235 8:130868753-130868775 TGAGAGAGAGGACTAGTAGCAGG + Intronic
1049652091 8:143774928-143774950 GGAGACGGAGGACAGATCGGAGG + Intergenic
1051344602 9:16140786-16140808 GGAGACAGAGGAAAAGTATTAGG - Intergenic
1051369747 9:16348261-16348283 GGAGACACAGGACCAATACTTGG + Intergenic
1052869912 9:33494521-33494543 GGAGACAGAAATCCAATAGCTGG + Intergenic
1053014765 9:34655448-34655470 GGAGACAGAGGTCAGAGAACAGG - Intronic
1055551978 9:77439833-77439855 GGAAAGAGAGGACAAAGAGTCGG + Intronic
1056263895 9:84877046-84877068 GGAGACAGTGGCCAAGTAGCAGG + Intronic
1056282152 9:85051998-85052020 GAACACTGAGGACAGATAGCTGG - Intergenic
1056884052 9:90422563-90422585 GGAGACATAGTTCAAAAAGCAGG - Intergenic
1057218728 9:93244287-93244309 AGAGACAGAGATGAAATAGCGGG + Intronic
1058656794 9:107229671-107229693 GGAGAGAGAGGAAAAATTGTCGG - Intergenic
1058983697 9:110192825-110192847 GCAGACAGAGGAGAAATACAAGG + Intronic
1059172045 9:112134586-112134608 AGACATAGAGGACAAATAGAGGG + Intronic
1059302815 9:113329147-113329169 GGAGACAGAGAACAACCAGGAGG - Intronic
1059578149 9:115514176-115514198 GGGGACAGAGGGTGAATAGCAGG + Intergenic
1059814565 9:117897867-117897889 GTAGACAGAAGACTAATACCTGG + Intergenic
1061508846 9:131048465-131048487 TGAGGCAGAGGCCAAATACCTGG - Intronic
1061912978 9:133734730-133734752 GAGGACAGAGGACCAATAGCTGG + Intronic
1203653469 Un_KI270752v1:1011-1033 GAAGTCAGAGGACAACTTGCTGG - Intergenic
1185566715 X:1100274-1100296 GGAGACAGAGGAGATAGAGATGG + Intergenic
1185567425 X:1106142-1106164 AGAGACAGAGGAGAGATAGAAGG + Intergenic
1185567435 X:1106249-1106271 AGAGACAGAGGAGAGATAGAAGG + Intergenic
1185592260 X:1285334-1285356 GGTGACAGAGGAAAATCAGCAGG + Intronic
1185642188 X:1594453-1594475 GGAGACACAGGTCATATAGTAGG + Intronic
1185789469 X:2917989-2918011 GGAGACAGAGAAGAAACCGCAGG + Exonic
1186273381 X:7914338-7914360 GGAGAGAGAGGACAGAAAGCAGG + Intronic
1187190521 X:17030746-17030768 GTTGAGAGAGGTCAAATAGCTGG + Intronic
1187285460 X:17899486-17899508 GGAGCTAGAGAAGAAATAGCCGG - Intergenic
1187323209 X:18260496-18260518 GGAGAAAGAGACCAAATGGCTGG + Intronic
1187505432 X:19874960-19874982 GGAGAGAGAGGAGAAAAAGAGGG + Intronic
1188043565 X:25399275-25399297 GGAGACTGAGGACTACTAGAAGG + Intergenic
1189547248 X:42054510-42054532 GGAGACAGAAGAGAGAGAGCTGG + Intergenic
1189724907 X:43958683-43958705 GGAGGCAGAGGACAAAAAATTGG + Exonic
1189993787 X:46619750-46619772 GGAGACAGGGCCCAAGTAGCTGG + Intronic
1190128444 X:47725404-47725426 GAGAAGAGAGGACAAATAGCGGG - Intergenic
1190780420 X:53589171-53589193 AGAAAAAGAGGACAAATATCAGG + Intronic
1191109130 X:56791329-56791351 GGAGACAGAGCAGAAATGGGAGG - Intergenic
1192522573 X:71815140-71815162 GGAGACAGAGGAGAAAGAGTAGG - Intergenic
1194700122 X:97103841-97103863 TGAGCAAGAGGCCAAATAGCAGG - Intronic
1195577366 X:106467100-106467122 GAAAACAAAGGACAAATAGATGG - Intergenic
1195940785 X:110166265-110166287 GGACACTGAGGAAAAGTAGCTGG - Intronic
1197019780 X:121673035-121673057 AGAATCAGAGGACAAAAAGCAGG - Intergenic
1197268568 X:124401871-124401893 GGAGGCACAGGACAACTGGCTGG - Intronic
1198425901 X:136520014-136520036 TGAGACTGAGGACAGAAAGCCGG + Intergenic
1198429000 X:136547160-136547182 GGAGACAAAGGAAGATTAGCCGG - Intronic
1198604900 X:138326288-138326310 GGAGACAGATGACAAATCACTGG - Intergenic
1199322231 X:146454037-146454059 GAAGGCAGAGGGCAAATAGCCGG - Intergenic
1199641598 X:149867736-149867758 GGAAACAGAAAACAAAAAGCAGG - Intergenic
1200234544 X:154461941-154461963 GGAGACAGAGGAGGGACAGCAGG - Intronic
1200366201 X:155667348-155667370 GAAGATACAGGACAAATAGGGGG + Intronic
1201184257 Y:11383398-11383420 GGAGACAGAGACCAAATTGAAGG + Intergenic