ID: 954702269

View in Genome Browser
Species Human (GRCh38)
Location 3:52456465-52456487
Sequence CGGGTAGTTCCCGACTTTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 17}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954702261_954702269 20 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG 0: 1
1: 0
2: 0
3: 2
4: 17
954702260_954702269 21 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG 0: 1
1: 0
2: 0
3: 2
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954702269 Original CRISPR CGGGTAGTTCCCGACTTTGA CGG Intronic
913675818 1:121139166-121139188 CATGTAGCTCCTGACTTTGAAGG - Intergenic
917456277 1:175188768-175188790 CAGGTAGTTCTCAACTTTTAAGG - Intronic
920109194 1:203575222-203575244 CCCTTGGTTCCCGACTTTGAGGG - Intergenic
920463186 1:206158003-206158025 CATGTAGCTCCTGACTTTGAAGG - Intergenic
922865003 1:228852303-228852325 GGGGAAGTTCACGTCTTTGAGGG + Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG + Intronic
1090259204 11:125306478-125306500 CTGGTAGTACCAGCCTTTGATGG - Intronic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1100342193 12:93690036-93690058 TGGGTAGTTCACAACTTTGAAGG + Intronic
942692547 2:178601497-178601519 GGGGTAGTTGCAGACTTTCATGG - Exonic
954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG + Intronic
959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG + Intronic
969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG + Intergenic
999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG + Exonic
1006257938 6:32845804-32845826 AGGGTAGTCCCCGGCTCTGACGG - Intronic
1007023833 6:38549676-38549698 AGGGTGGTTCCCTACTCTGAAGG - Intronic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1030377471 7:108770320-108770342 CTTCTAGTTCCTGACTTTGATGG - Intergenic
1052298559 9:26927468-26927490 AGGGTAGTTACCAACTTTTAAGG + Intronic