ID: 954702270

View in Genome Browser
Species Human (GRCh38)
Location 3:52456466-52456488
Sequence GGGTAGTTCCCGACTTTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954702261_954702270 21 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702270 3:52456466-52456488 GGGTAGTTCCCGACTTTGACGGG 0: 1
1: 0
2: 0
3: 1
4: 31
954702260_954702270 22 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702270 3:52456466-52456488 GGGTAGTTCCCGACTTTGACGGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954702270 Original CRISPR GGGTAGTTCCCGACTTTGAC GGG Intronic
900565073 1:3328123-3328145 GGCTAGTTCCCCACTTGGCCCGG - Intronic
914848867 1:151299250-151299272 GTGTAGTTTCTGACTTTGTCAGG - Intronic
921603590 1:217133246-217133268 GGGCTTTTCCCGCCTTTGACGGG - Intronic
922865004 1:228852304-228852326 GGGAAGTTCACGTCTTTGAGGGG + Intergenic
1075135572 10:119782557-119782579 GGGTGGCTCCTGTCTTTGACAGG + Intronic
1087462823 11:98466841-98466863 GGGAAGTTCTCGCCTTTGCCAGG + Intergenic
1107813179 13:44219482-44219504 GGGCAGCTCCCGACCTGGACAGG + Intergenic
1116547511 14:46187305-46187327 GGGTGGTTCCCTAAATTGACTGG - Intergenic
1122854311 14:104552851-104552873 GGGCAGTTCCAGACTTTCCCTGG - Intronic
1129936761 15:79457268-79457290 AGGAAGTTCCTGACTTTGAACGG + Exonic
1133005623 16:2880035-2880057 GGGAACTACCCGACTTTGAGAGG + Intergenic
1140576567 16:76176760-76176782 TAGTAATTCCCGAGTTTGACAGG + Intergenic
1143921762 17:10336002-10336024 GGGTCGTGTCCGACTTGGACTGG + Intronic
932100825 2:68897508-68897530 GAGAAGTTTCCGACTTTGCCTGG - Intergenic
938038257 2:128054257-128054279 GAGAAGTTCCCGACTTTACCTGG - Intergenic
1171985428 20:31657289-31657311 CTGTAATTCCAGACTTTGACAGG - Intergenic
1172684922 20:36746193-36746215 CGGTAGTTCCCGAGGTGGACGGG - Intergenic
1178346642 21:31834183-31834205 GTGTTGCTCCCCACTTTGACTGG - Intergenic
953337972 3:42110245-42110267 GGGCAGTTCCCGGCTGTGGCTGG + Intronic
954702270 3:52456466-52456488 GGGTAGTTCCCGACTTTGACGGG + Intronic
959985030 3:112562363-112562385 GGGTAGTCCCTGACTGTGAAGGG + Intronic
966313078 3:178615983-178616005 GGGAACTTCACGACTCTGACTGG + Intronic
984352914 4:178618870-178618892 GGGCAGTTCCCAACTTTTAGAGG - Intergenic
988918826 5:35922130-35922152 GGGAAGTGCCAGAATTTGACTGG - Intronic
1002932037 6:1641432-1641454 AGGTATTTCCCTCCTTTGACAGG - Intronic
1006647130 6:35522530-35522552 TGGTAGTTCCCCGCTTTGGCTGG - Intergenic
1011233225 6:85187387-85187409 GAGAAGTTCCCGACTTTACCTGG + Intergenic
1014674714 6:124349296-124349318 GGGAAGTTCCCGCCTTTGTAGGG - Intronic
1030888986 7:114973827-114973849 AGGTAGTTACAGAATTTGACTGG + Intronic
1031995539 7:128227967-128227989 GGATAGTTTCTGAATTTGACTGG - Intergenic
1035958438 8:4109563-4109585 GCGTAGTTCCAGACATTGACTGG - Intronic
1191877326 X:65809873-65809895 GGGTGGTTGTAGACTTTGACTGG - Intergenic
1194502170 X:94695111-94695133 GGCTAGTTCCAGGCTTTGAATGG - Intergenic