ID: 954702270 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:52456466-52456488 |
| Sequence | GGGTAGTTCCCGACTTTGAC GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 33 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 31} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 954702261_954702270 | 21 | Left | 954702261 | 3:52456422-52456444 | CCACACACACTTCTAAGCTATGG | 0: 1 1: 0 2: 0 3: 11 4: 126 |
||
| Right | 954702270 | 3:52456466-52456488 | GGGTAGTTCCCGACTTTGACGGG | 0: 1 1: 0 2: 0 3: 1 4: 31 |
||||
| 954702260_954702270 | 22 | Left | 954702260 | 3:52456421-52456443 | CCCACACACACTTCTAAGCTATG | 0: 1 1: 0 2: 0 3: 8 4: 174 |
||
| Right | 954702270 | 3:52456466-52456488 | GGGTAGTTCCCGACTTTGACGGG | 0: 1 1: 0 2: 0 3: 1 4: 31 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 954702270 | Original CRISPR | GGGTAGTTCCCGACTTTGAC GGG | Intronic | ||