ID: 954702271

View in Genome Browser
Species Human (GRCh38)
Location 3:52456467-52456489
Sequence GGTAGTTCCCGACTTTGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954702260_954702271 23 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702271 3:52456467-52456489 GGTAGTTCCCGACTTTGACGGGG 0: 1
1: 0
2: 0
3: 0
4: 19
954702261_954702271 22 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702271 3:52456467-52456489 GGTAGTTCCCGACTTTGACGGGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954702271 Original CRISPR GGTAGTTCCCGACTTTGACG GGG Intronic
922865005 1:228852305-228852327 GGAAGTTCACGTCTTTGAGGGGG + Intergenic
1085326548 11:75610855-75610877 GGTAGTCCCCCACTGAGACGTGG + Intronic
1112088136 13:96053202-96053224 GGCAGTCACCGACTTGGACGCGG + Exonic
1120026206 14:79587089-79587111 GGTTGTGCCAGACTTTCACGGGG + Intronic
1142311046 16:89313968-89313990 GGTAGTTCACGCCTGTGATGCGG + Intronic
929330160 2:40673166-40673188 GATAGTCCCCGACCCTGACGGGG - Intergenic
940193507 2:151067304-151067326 GGGAGTTCAGGACTTTGACCTGG - Intergenic
942459739 2:176160639-176160661 TGTATTTCCCGACTATGAGGGGG + Intronic
954702271 3:52456467-52456489 GGTAGTTCCCGACTTTGACGGGG + Intronic
990434924 5:55780020-55780042 GGTAGTTTCCGAGGTTGCCGTGG + Exonic
1003035849 6:2639689-2639711 GGCAGCTCCCCACTTTGCCGAGG - Intergenic
1006070334 6:31494014-31494036 GGTCCCTCCCGTCTTTGACGGGG + Intergenic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1030888987 7:114973828-114973850 GGTAGTTACAGAATTTGACTGGG + Intronic
1035958437 8:4109562-4109584 CGTAGTTCCAGACATTGACTGGG - Intronic
1038607151 8:29018846-29018868 GGTACTTTCCGACTGCGACGAGG + Exonic
1058487920 9:105460747-105460769 GTTAGCTGCCAACTTTGACGTGG + Intronic
1060597130 9:124855401-124855423 GGGAGGTCCCTACTTTGACTTGG + Intronic
1060937432 9:127523821-127523843 GGCACTGCCCGACTTTGCCGTGG + Exonic
1200920339 Y:8607447-8607469 GGCATTTCCAGACTTTGAGGTGG - Intergenic