ID: 954702272

View in Genome Browser
Species Human (GRCh38)
Location 3:52456471-52456493
Sequence GTTCCCGACTTTGACGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954702261_954702272 26 Left 954702261 3:52456422-52456444 CCACACACACTTCTAAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 954702272 3:52456471-52456493 GTTCCCGACTTTGACGGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 34
954702260_954702272 27 Left 954702260 3:52456421-52456443 CCCACACACACTTCTAAGCTATG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 954702272 3:52456471-52456493 GTTCCCGACTTTGACGGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954702272 Original CRISPR GTTCCCGACTTTGACGGGGT TGG Intronic
904276144 1:29385550-29385572 GTTCCCAGCCTTGACAGGGTAGG + Intergenic
907537838 1:55181256-55181278 GTTACAGACTTTGTTGGGGTGGG - Intronic
915480651 1:156182410-156182432 GTACCCTACCTTGAAGGGGTGGG - Intergenic
921189299 1:212695700-212695722 GTTCTTGTCTTTGTCGGGGTTGG - Intronic
1090414502 11:126531349-126531371 GTTCCCCTCTTTTAAGGGGTGGG + Intronic
1097451890 12:59746780-59746802 CTTTCTGACTTTGAGGGGGTAGG - Intronic
1105792201 13:23812566-23812588 GTTCCAGACCATGACGGGATGGG + Intronic
1136239846 16:28937163-28937185 GTTCCCCACATGGAGGGGGTTGG + Intronic
1139095954 16:63704718-63704740 AATTCCTACTTTGACGGGGTTGG + Intergenic
1139282700 16:65784231-65784253 GTTCCCCACTTTATAGGGGTTGG + Intergenic
1141091076 16:81130689-81130711 TTTCCTGACTTGGACTGGGTGGG - Intergenic
1143458518 17:7083863-7083885 GATGCAGACTTTGAAGGGGTTGG + Intergenic
1145856251 17:28161096-28161118 GGTCACCACTTTGAGGGGGTAGG + Intronic
1147996581 17:44363191-44363213 GCTCCCGACCCTGGCGGGGTGGG - Intronic
1158726782 18:59980837-59980859 GTTCCCCACCATGACGGGGCAGG - Intergenic
1159593601 18:70361216-70361238 GTTCCCAGCTATGACTGGGTAGG - Intergenic
1160432812 18:78823576-78823598 GTTCCCATCTTTGAGGGGGAGGG - Intergenic
1162995607 19:14333327-14333349 GTTCCTTACTTTGATGGGGTGGG + Intergenic
1165956095 19:39503076-39503098 GTCCCCGGCTGGGACGGGGTGGG - Intronic
1166814199 19:45532524-45532546 GTTCCAGACTGGGAAGGGGTAGG - Intronic
1168374785 19:55867625-55867647 CTTCCCGACTCTGACAGGATTGG + Intronic
944641183 2:201727659-201727681 GTAACAGACTTGGACGGGGTGGG + Intronic
952432432 3:33236727-33236749 CTTCTGGTCTTTGACGGGGTTGG - Intergenic
954702272 3:52456471-52456493 GTTCCCGACTTTGACGGGGTTGG + Intronic
956764827 3:72475690-72475712 GTCCCAGACTTTGAAGGGGAAGG - Intergenic
966170469 3:177074504-177074526 GTGCCCGATTTTGAGGTGGTTGG - Intronic
982398206 4:154936822-154936844 GATCCTGAGTTTGAGGGGGTTGG + Intergenic
986471825 5:8083670-8083692 GTTCCCGGCCATGACGGGATGGG - Intergenic
996327162 5:122287806-122287828 CTTCCCTACTTTGTCTGGGTGGG - Intergenic
997722546 5:136090839-136090861 GTTCCTGACTTTTAGGGGCTGGG + Intergenic
1002204839 5:177555110-177555132 GTTCCCGAGTCTGATGGGGAAGG + Intergenic
1020934702 7:14447821-14447843 TTTCTTGACTTTGACGGTGTCGG + Intronic
1032296320 7:130642127-130642149 ATTCCAGACTTTCACTGGGTGGG + Intronic
1049689372 8:143952010-143952032 GTTCCCGGGTTTGCCGGGCTTGG - Intronic
1059446747 9:114342739-114342761 GTGCCTGACTCTGCCGGGGTGGG - Intronic
1062501839 9:136855097-136855119 GTTCCCTACCTGGAAGGGGTAGG - Exonic