ID: 954702283

View in Genome Browser
Species Human (GRCh38)
Location 3:52456514-52456536
Sequence GTGGGCTGCCTGGCAAAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954702273_954702283 17 Left 954702273 3:52456474-52456496 CCCGACTTTGACGGGGTTGGATG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG 0: 1
1: 0
2: 1
3: 9
4: 136
954702279_954702283 -6 Left 954702279 3:52456497-52456519 CCAGGCCTGTGAGCCTGGTGGGC 0: 1
1: 0
2: 8
3: 30
4: 299
Right 954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG 0: 1
1: 0
2: 1
3: 9
4: 136
954702274_954702283 16 Left 954702274 3:52456475-52456497 CCGACTTTGACGGGGTTGGATGC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954702283 Original CRISPR GTGGGCTGCCTGGCAAAAAC CGG Intronic
900491257 1:2950257-2950279 GAGGGGTGCCTGGCAGGAACGGG - Intergenic
901281956 1:8044361-8044383 GTGGTCTTCCTCTCAAAAACTGG - Intergenic
902191137 1:14764143-14764165 GTGGGCCTCCTGGGAAAGACCGG + Intronic
903140300 1:21335176-21335198 GGGGGCAGCCGGGCAAAGACGGG - Intronic
904649999 1:31998311-31998333 CTGGGCAACCTGGCAAAACCTGG + Intergenic
905279764 1:36841639-36841661 CTGGGCAGCCTGGCAGAAAAAGG - Intronic
906184005 1:43846586-43846608 GAGGACTGCCTGACACAAACAGG - Intronic
906581748 1:46940838-46940860 CTGTGCTCCCTGGCAAACACAGG + Intronic
910411123 1:86945876-86945898 CTGGGCAGCATGGCAAAACCTGG + Intronic
913539894 1:119808714-119808736 CTGAGCTGCCTGGCCAAAACAGG - Exonic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
915075559 1:153305923-153305945 GTCAGCTGCATTGCAAAAACTGG + Intronic
915224623 1:154403539-154403561 GTGAGCTGCCAGCCTAAAACAGG - Intergenic
917124108 1:171670772-171670794 GTGTCCTGGCTGGCAAAGACAGG - Intergenic
917403393 1:174677501-174677523 GTGGGGTACATGGCAAAAGCAGG - Intronic
917453063 1:175163176-175163198 CTGGGCTGCTTGCCAAAAATGGG - Intronic
918725859 1:187922711-187922733 TACTGCTGCCTGGCAAAAACTGG - Intergenic
920551820 1:206868017-206868039 GTGAGGAGACTGGCAAAAACAGG - Intronic
922988442 1:229884972-229884994 GTGGGCTGCTTGCCAACACCAGG - Intergenic
1065748456 10:28863277-28863299 GTGGGCAACATGGCAAAATCTGG - Intronic
1066407767 10:35135480-35135502 GTGGGCATTCTGGCAAAAACCGG - Intronic
1068733137 10:60382226-60382248 GTGGACTGCATGGTAAAAAATGG - Intronic
1069223033 10:65907264-65907286 ATGGGGTGGCTGGCCAAAACAGG - Intergenic
1070257017 10:74821704-74821726 GTGGGCTACCTGCAAAAACCAGG + Intergenic
1073493469 10:103871072-103871094 GTGGTCTGCCTTGCAGAACCTGG + Intergenic
1075452378 10:122560377-122560399 GTGGGCTGCTGAGCAAATACAGG - Intergenic
1077186572 11:1238137-1238159 GTGGGCTGCCTGGAGGAAGCAGG + Intronic
1077775618 11:5268510-5268532 GCAGGCTGCCTGGCAGAAGCTGG - Exonic
1078275718 11:9843815-9843837 GTGGGCTTTCTGGCAAAAACTGG + Intronic
1078922216 11:15841312-15841334 TTGGGCTGGGTGGCAAAAGCAGG + Intergenic
1083334285 11:61913733-61913755 GTGGGGTGCCTGGCACATAATGG - Intronic
1083357940 11:62081490-62081512 CTGGGCTACATGGCAAAACCTGG - Intergenic
1084488435 11:69464435-69464457 GTGGGCAGCCTGGCAACCCCAGG - Intergenic
1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG + Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1094025296 12:25955475-25955497 GTGGGCTGTTTGGGAAATACTGG + Intergenic
1095465943 12:42488157-42488179 GGGGGCTGCCTTGGAACAACAGG - Intronic
1096513490 12:52144521-52144543 ATGGGCGGCCTAGCAAAACCAGG + Intergenic
1102016338 12:109650405-109650427 CTGGGCAGCATGGCAAAACCTGG + Intergenic
1102144638 12:110645607-110645629 GTGGGCTGCCTGTGTAGAACAGG - Intronic
1102389518 12:112538133-112538155 CAGGACTGCCTGGCAATAACAGG + Intergenic
1103526728 12:121574228-121574250 GTGGGTTGCCGGGTAAACACTGG - Intronic
1105465182 13:20633375-20633397 GTGGCCTGCCTCCCAAAAAAGGG + Intronic
1108839435 13:54593682-54593704 GTTGGCAGCCTGGCAACCACCGG + Intergenic
1114452232 14:22834946-22834968 CTTGACTGCCTGGCCAAAACTGG - Exonic
1117718063 14:58600918-58600940 CTGGATTGCCTGGCAAGAACTGG + Intergenic
1117953577 14:61105899-61105921 GTGGGCTGCCTGTCCTCAACAGG + Intergenic
1121265629 14:92600644-92600666 GTGTGCTGCCTGGCACACAGTGG - Intronic
1122755027 14:103971674-103971696 GTTGGCTTCCTGGCAAGATCTGG - Intronic
1124558151 15:30746824-30746846 GAGGGCAGCCTGGCCAAAACGGG - Intronic
1128544883 15:68560129-68560151 GGGGGCTGCCTGGGAAGATCCGG + Intergenic
1131092275 15:89631954-89631976 GTGGCCCTCCTGGCAAGAACAGG + Intronic
1133378822 16:5312986-5313008 GTGGTGTGCCTGGAAAAAAAAGG - Intergenic
1137811327 16:51355580-51355602 GGGGGCTCCCTAGCAAAGACTGG - Intergenic
1139417519 16:66825902-66825924 GTGCTGTGCCTGGCAGAAACTGG + Intronic
1141849678 16:86636766-86636788 GTGGGCTGCCCAGCAAAGGCAGG - Intergenic
1142571487 17:877799-877821 CTGGCCTGCCTGGTGAAAACCGG - Intronic
1144631963 17:16878252-16878274 CTGGGCTGCCTGGCAGGCACTGG + Intergenic
1144675371 17:17158363-17158385 GTGGCCTGCCAGGCAGAAGCTGG - Intronic
1147603263 17:41758862-41758884 GATGGTTGCCTGGCAAAAAAAGG + Exonic
1150055923 17:62015992-62016014 CTGGGCAACATGGCAAAAACCGG - Intronic
1151311224 17:73293502-73293524 GTGGCCTGCCAGGCAAAACCTGG - Intronic
1151559651 17:74863418-74863440 GGGGTCGGCCTGGTAAAAACAGG - Intronic
1151785717 17:76273962-76273984 GGGGGCTGCCTGGCCAACAGCGG + Intergenic
1153143972 18:2007750-2007772 GTGGGGTGCCGGGAAAAAAATGG + Intergenic
1157659227 18:49424439-49424461 TTGTACTGACTGGCAAAAACTGG + Intronic
1160823633 19:1069367-1069389 CTGGGCTGCCAGGGACAAACAGG - Intronic
1162796698 19:13090836-13090858 GTGGGCTGCGTGCCCAGAACTGG + Intronic
927603043 2:24461269-24461291 GTGGGCAGCCTGGCAAGACAGGG - Intergenic
927860745 2:26558578-26558600 GTGGGCTGCCTGGCACTGCCAGG + Exonic
929897044 2:45969626-45969648 GGGGGTTGCTTGGCACAAACAGG - Intronic
930022276 2:47008669-47008691 GAGGGCTGCCTGGGACAATCAGG - Intronic
932298711 2:70647984-70648006 GGGGGCTGCCTGTCAGAAAAAGG + Intronic
933728829 2:85441916-85441938 GGGGGCTTTCTGGTAAAAACTGG + Intergenic
935352936 2:102169985-102170007 GTGGCCAGCAGGGCAAAAACTGG - Intronic
940778692 2:157910512-157910534 GTGGGCTGCCTGGCAGGCAGTGG + Intronic
1170549961 20:17468353-17468375 GTAGGCTGCCTGTCTACAACAGG - Intronic
1170549972 20:17468406-17468428 GTAGGCTGCCTGTCTACAACAGG - Intronic
1170550045 20:17468727-17468749 GTGGGCTGCCTGTCTACAGCAGG - Intronic
1175786038 20:61712313-61712335 GTGGGCTGCCTGGCCAAGGTGGG + Intronic
1176193145 20:63823302-63823324 GTGGGCAACATGGCAAAACCTGG + Intronic
1178848378 21:36192572-36192594 CTGGGCAACATGGCAAAAACCGG - Intronic
1180127264 21:45800987-45801009 GTGGGCATGCTGGCAAGAACGGG - Intronic
1180180514 21:46116777-46116799 CTGGCCTGGCTGGCAAGAACGGG + Exonic
1181525804 22:23485585-23485607 GTGGCCTGGCTGGCACAGACAGG + Intergenic
1183784462 22:40021536-40021558 CTGGGCTGCCCGGCAACAGCGGG + Exonic
1184362435 22:44026409-44026431 TTGGGGTGCCTGGCAAACAGAGG + Intronic
949715687 3:6928627-6928649 GTTGTTTGCCTGGCAAAATCTGG - Intronic
950431674 3:12954473-12954495 GGGGGCTGCGTGGCAAACATGGG + Intronic
950943310 3:16917004-16917026 GTAGGTTGCCTGGCAGTAACTGG + Intronic
951807985 3:26667776-26667798 GTGTTGTGCCTGGCAAAAACAGG + Intronic
952047759 3:29344671-29344693 GTGGTCTGGGTGGCAAATACTGG - Intronic
954075934 3:48180367-48180389 AAGGGCTTTCTGGCAAAAACCGG - Intronic
954421047 3:50419202-50419224 GTGGGCTCCCTCTCTAAAACAGG + Intronic
954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG + Intronic
955818743 3:62874614-62874636 GTGGGCTGCTTGGCATTAAAGGG + Exonic
956309027 3:67858747-67858769 GTGGACTCCCTTGCACAAACTGG - Intergenic
962163445 3:133023804-133023826 GTGGGCTGCCTGCCAGGAAGGGG - Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
963854232 3:150237700-150237722 GTGGGCTGCCAGGAAGAATCTGG + Intergenic
965012775 3:163116541-163116563 GTGGACTGCCTTGTAAACACTGG - Intergenic
969618844 4:8268999-8269021 CTGGGCTGCCTGGCGAAGCCTGG - Intergenic
969694633 4:8727725-8727747 CTGGGCTGCCGGGCAGACACTGG + Intergenic
970837762 4:20431435-20431457 GCAGCCTGCCTGGCAAAAGCAGG + Intronic
972830170 4:42805805-42805827 GTGAGCTACCTGGCCAAACCAGG - Intergenic
975457020 4:74603971-74603993 GTGGGCTCCCTAGCAATAATTGG + Intergenic
977720522 4:100235449-100235471 TTGGTCTGGCTGGCAAAAAGGGG + Intergenic
981788024 4:148502974-148502996 CTGGGCTTCCTGCAAAAAACTGG - Intergenic
985099907 4:186448611-186448633 TCTGGCTGCCTGGGAAAAACAGG - Intronic
990973612 5:61537362-61537384 CTGGGCTGCCTTGCAATACCTGG - Intronic
1002029488 5:176417133-176417155 GTAGGCTGCCTGGGTAAACCAGG - Intergenic
1002088296 5:176789643-176789665 GGGCGCTGCCTCGCAAACACTGG + Intergenic
1004178445 6:13360838-13360860 GTTTCCTGCCTGGCAAGAACAGG + Exonic
1004488870 6:16094719-16094741 GTGGGCTGCCAGACCAAAACTGG + Intergenic
1006305372 6:33215326-33215348 GAGGGCTGCCAGGCAAGGACAGG - Intergenic
1009914345 6:69974601-69974623 GTGGGCCACCTGTCAAAATCCGG - Intronic
1011105938 6:83781627-83781649 GTGAGTTGCCTGACAAAAATAGG - Intergenic
1013053826 6:106563791-106563813 GTGGGCAGCCTGGTAACATCTGG + Exonic
1014866165 6:126532956-126532978 GTGGGCTGGGTGGAAGAAACAGG + Intergenic
1016647956 6:146431998-146432020 GTGGTGTCCCTGGCAAGAACAGG - Intronic
1017401869 6:154073810-154073832 CTGGCCAGCATGGCAAAAACTGG + Intronic
1017787758 6:157770362-157770384 GTTGGCTGCCTGAGTAAAACAGG + Intronic
1018450600 6:163903662-163903684 GGGGGCTGACTGAGAAAAACTGG - Intergenic
1025036649 7:55597418-55597440 ATGGCCTGCCTGGCTACAACTGG - Intergenic
1025108028 7:56189161-56189183 GTTGGCTGCCTTGCAGAAGCTGG - Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1033421500 7:141208399-141208421 GTGGGCTGCCTAATACAAACAGG - Intronic
1034609838 7:152356373-152356395 GAGGCCAGCCTGGCAAACACTGG + Intronic
1035176944 7:157058248-157058270 TTGGGCTGCCTGGCAGGCACGGG - Intergenic
1040384720 8:46906595-46906617 GTGCTTTGCCTGGCAAAAGCTGG - Intergenic
1043719056 8:83521989-83522011 GAAGGCAGCCTGGCAAAAATAGG + Intergenic
1046717224 8:117580919-117580941 GTGGGTTGCCTGAAAAACACAGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050157132 9:2679494-2679516 GTGGCTTGCCTGGGAAAAATAGG - Intergenic
1050738913 9:8797172-8797194 GGGGGCTTTCTGGCAAAAATTGG - Intronic
1053431408 9:38044036-38044058 GTGGGCTGCCAGGCAGAACCAGG - Intronic
1056475658 9:86948645-86948667 GTCTGCGGCCTGTCAAAAACTGG + Intergenic
1056633445 9:88312696-88312718 GTGGGGTGCCGGGCACAAGCAGG - Intergenic
1059733252 9:117077070-117077092 CTGGGCTGCCTGGTAACAAACGG - Intronic
1060443107 9:123660156-123660178 CTGGGCTCCCTGTCTAAAACGGG + Intronic
1062160479 9:135076897-135076919 GTGGGCTTCCAGGCAAAACAAGG - Intronic
1186115935 X:6305186-6305208 ATATGCTACCTGGCAAAAACTGG + Intergenic
1189141218 X:38608254-38608276 GGGGGCTTTCTGGTAAAAACCGG - Intronic
1189573073 X:42320414-42320436 TTGGACTGTCTTGCAAAAACTGG + Intergenic
1190132976 X:47768362-47768384 CTGGGCTTCCTGGCAAAAGCAGG + Intergenic
1192111672 X:68371407-68371429 GTGGGCAGCATGGCAAAACTCGG - Intronic
1195617769 X:106926670-106926692 GTGGGCAACATGGCAAAACCTGG + Intronic