ID: 954704281

View in Genome Browser
Species Human (GRCh38)
Location 3:52470847-52470869
Sequence TGTTCTCTGCAGGAGATAAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954704277_954704281 19 Left 954704277 3:52470805-52470827 CCAGGGACTGGGGTCAGGTGGAC 0: 1
1: 0
2: 4
3: 34
4: 319
Right 954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG 0: 1
1: 0
2: 2
3: 21
4: 264
954704274_954704281 21 Left 954704274 3:52470803-52470825 CCCCAGGGACTGGGGTCAGGTGG 0: 1
1: 0
2: 4
3: 28
4: 361
Right 954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG 0: 1
1: 0
2: 2
3: 21
4: 264
954704276_954704281 20 Left 954704276 3:52470804-52470826 CCCAGGGACTGGGGTCAGGTGGA 0: 1
1: 0
2: 4
3: 27
4: 299
Right 954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG 0: 1
1: 0
2: 2
3: 21
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954704281 Original CRISPR TGTTCTCTGCAGGAGATAAA TGG Exonic
900508191 1:3040544-3040566 TGATCAGTGTAGGAGATAAAAGG - Intergenic
902048840 1:13545924-13545946 TGTACTCTGAAGGGGATTAAAGG - Intergenic
903507186 1:23845850-23845872 TGTTATCTGCAGAAAACAAAAGG + Exonic
906318322 1:44802022-44802044 TGATGTGTGCATGAGATAAATGG + Intronic
908189552 1:61688159-61688181 TGTTTTCCTCAGGATATAAATGG - Intronic
908580752 1:65513594-65513616 TATTCTCTGCAGGAGTATAATGG - Intronic
908813740 1:68010685-68010707 TGTTTTGTGCAGGAAATACAAGG - Intergenic
909226774 1:73034533-73034555 TGTTTTCAGCAAGAGAAAAATGG + Intergenic
910141020 1:84027873-84027895 TTTTCTCTGCAGAGCATAAATGG - Intergenic
910297136 1:85659509-85659531 TTTTTTGAGCAGGAGATAAAAGG - Intronic
912626965 1:111213310-111213332 TATTCTCTGCAGGAGCACAAAGG - Intronic
913217024 1:116629172-116629194 TGTTCTCTGCAGTTTTTAAATGG - Intronic
914348626 1:146821010-146821032 TGGTCTCTGCAGGAGCTGAAGGG + Intergenic
914833607 1:151189465-151189487 TGTTCTGTGGAAGAAATAAATGG + Intronic
915001687 1:152600191-152600213 TGTACACTGCACGGGATAAAAGG + Intronic
916786862 1:168092848-168092870 TGTCCTTCGCAGGAGATAACGGG + Intronic
917902595 1:179557319-179557341 TTTTCTCCGCAAGAGAAAAATGG + Intronic
919201714 1:194363583-194363605 TTTTCTCTGTAGGAAATAATAGG + Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919562537 1:199139715-199139737 TGTGTTCTGCAGAAGAGAAATGG - Intergenic
919713682 1:200753422-200753444 AGTTCTCTGCAGGAGCTGACTGG + Intronic
921505473 1:215963599-215963621 TATTACCAGCAGGAGATAAATGG + Intronic
921742294 1:218699303-218699325 AGTTTTCTGCAAGAGAAAAATGG + Intergenic
921805043 1:219444604-219444626 TATTCCCTTTAGGAGATAAAAGG - Intergenic
922958830 1:229626879-229626901 TGTTCTCTGCAGTAGAGTGAAGG + Intronic
924377042 1:243421832-243421854 TGTTTTTTGAAGGAGGTAAACGG + Intronic
1062862493 10:821813-821835 AGTTTTCTGTAGGAGATAATAGG - Intronic
1062926665 10:1321241-1321263 TGCTCTCTGCAAGAGAGAAGAGG - Intronic
1063497292 10:6521748-6521770 AGTGCTCTGCAAGAGATAGATGG - Intronic
1063710624 10:8474251-8474273 TGTTCTTTCCTGGAGGTAAAAGG + Intergenic
1064509942 10:16079336-16079358 TGTTATCTGCTGGAAATCAAGGG + Intergenic
1066249128 10:33615984-33616006 TGTTATCTGCAGGAGAAATTGGG - Intergenic
1067046037 10:42985732-42985754 TGTTCTCTGCCCGAGACAACAGG - Intergenic
1067130004 10:43555290-43555312 TCTTCTCTGCAGAAGTTGAATGG - Intergenic
1067414766 10:46094878-46094900 TGTTGTCTGCAGGAGAAGCAAGG + Intergenic
1068200928 10:53783383-53783405 TGTTCCCTGAAAGAGAGAAATGG - Intergenic
1068308465 10:55247433-55247455 TGTTCTTTGCAGAGTATAAATGG - Intronic
1070444253 10:76479533-76479555 TGTGCTCTGCAGGACATTAAAGG - Intronic
1071417080 10:85451402-85451424 GCTTCACTGCAGCAGATAAATGG + Intergenic
1071736978 10:88311903-88311925 TGCTATCTGCAAGAGATAAGAGG - Intronic
1073865068 10:107793091-107793113 TTTTCTCTGAGGGAGCTAAAAGG + Intergenic
1074666011 10:115725518-115725540 TGTTCTCCTCAGCATATAAACGG - Intronic
1075135067 10:119777206-119777228 TGTTCACTGTAGGATAGAAATGG + Intronic
1075923238 10:126230273-126230295 TGTTAGCTGCAGGAAATATAAGG - Intronic
1075946432 10:126437220-126437242 TATTCTCTGCAAAAGATATAAGG + Intronic
1077180663 11:1212315-1212337 TCTTTTCTACAGGATATAAAAGG + Intergenic
1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG + Intronic
1080928855 11:36786253-36786275 TGTTTAGTGCAGGAAATAAAGGG - Intergenic
1081236879 11:40657385-40657407 TGTTCTCTGTAGGGCATGAAAGG + Intronic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1081984293 11:47290343-47290365 TTTTCTCTTCAGGAGACAAGTGG - Intronic
1082910683 11:58370870-58370892 TATTTTCTTTAGGAGATAAAAGG - Intergenic
1083582340 11:63832910-63832932 TGTTCTCTCTAGGGGAGAAAGGG - Intergenic
1086687653 11:89750982-89751004 TGTTCTATGCAGGCCTTAAATGG - Intergenic
1086718199 11:90088913-90088935 TGTTCTATGCAGGCCTTAAATGG + Intergenic
1086822399 11:91449926-91449948 TGTTCTATGTATGAGACAAAAGG + Intergenic
1086970178 11:93073023-93073045 TGTTCTCTGCAGGAGTAACTGGG - Intergenic
1089358788 11:117872995-117873017 TGTTCTCTGGAAGAGACAACTGG - Intronic
1089922028 11:122218136-122218158 TGTTTTCTGCAGGAGAGAAATGG - Intergenic
1091932809 12:4410347-4410369 TCTTATCTGCAGGAGATATTGGG + Intergenic
1093057343 12:14568089-14568111 GGTCCGCTGCTGGAGATAAATGG - Exonic
1093253372 12:16835980-16836002 TATTGTCAGCAGTAGATAAATGG - Intergenic
1093615440 12:21216775-21216797 TGTGCTCTGCAGAGGGTAAAAGG + Intronic
1093718531 12:22411591-22411613 TGTTCCCTGCAGTTGATAAGTGG + Intronic
1093792537 12:23270310-23270332 GGTTCTGTGAAGGAAATAAATGG + Intergenic
1097423155 12:59407078-59407100 TTTACTCTGTTGGAGATAAATGG + Intergenic
1097637845 12:62144114-62144136 CCTTCTCTGCAGGAAACAAATGG + Intronic
1098832016 12:75374932-75374954 TGGCCTGTGCAGAAGATAAATGG - Intronic
1102790400 12:115639659-115639681 TGGTCTCAGCCTGAGATAAAAGG - Intergenic
1103538737 12:121651639-121651661 TGTTCTCTGCAGGGGAGAGAGGG + Exonic
1103857527 12:123983641-123983663 TTTACTCTGCAGAAGAAAAATGG - Intronic
1104880284 12:132065938-132065960 TTATCTCTGCAGGACATAAGGGG - Intronic
1106167297 13:27259564-27259586 TGCTCTCTGAAGCAGATAAATGG - Intergenic
1107382824 13:39875645-39875667 TGTTTTCTGGAGGACATGAAGGG + Intergenic
1108613374 13:52106267-52106289 TGGACTTTGAAGGAGATAAATGG - Intronic
1109596579 13:64563811-64563833 TGTTCATTGCAGTATATAAAAGG + Intergenic
1110000397 13:70191129-70191151 TGTTTTCTTAAGGAGAAAAATGG - Intergenic
1112926649 13:104683535-104683557 TGTTCCCTGCAGCAGCCAAAGGG + Intergenic
1113060313 13:106315213-106315235 TGTTTTCAGCAGGAGAGAAAGGG - Intergenic
1113310403 13:109126548-109126570 TTTTCTCTGCTGGAACTAAACGG + Intronic
1114793668 14:25687342-25687364 TTTTCTCTGCAGTAGATTGAAGG - Intergenic
1119495244 14:75072315-75072337 AGTTCTCTCCAGGTGACAAAAGG - Intronic
1119982183 14:79094145-79094167 TGATCTCTGCCGGGGAGAAATGG + Intronic
1120580137 14:86237443-86237465 TGTTCATTGCAGGAGAAATAGGG - Intergenic
1120580395 14:86240676-86240698 TGTTCATTGCAGGAGAAATAGGG + Intergenic
1121291901 14:92782827-92782849 TGCTCCCTGTAGGAGATAAGGGG + Intergenic
1122861567 14:104584903-104584925 CGTCCTCTACAGGAGATAACAGG - Intronic
1123826275 15:24085604-24085626 TGGCCTATGCAGAAGATAAATGG - Intergenic
1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG + Intronic
1126286298 15:47015706-47015728 TGTTATCTACAGTAGAAAAATGG - Intergenic
1126535854 15:49763409-49763431 TGTTCTTTTCAGGAGCTAAAAGG - Intergenic
1127263851 15:57345784-57345806 GGTTTTCTGCAGGAGAGTAATGG - Intergenic
1128302677 15:66576599-66576621 TGTTTTCTTCAGGAGTTAACCGG - Intergenic
1128355500 15:66923646-66923668 TGATCTCTGCAGGAGATCAGGGG + Intergenic
1129237605 15:74233123-74233145 CGTTCAGAGCAGGAGATAAAGGG - Intergenic
1131220759 15:90582130-90582152 CTTCCTCTGGAGGAGATAAATGG + Intronic
1131451957 15:92548932-92548954 TCTTCTCTGCAGGAGTATAAAGG + Intergenic
1133450573 16:5900643-5900665 TGTCCTTTGCAGGAGCTAATAGG + Intergenic
1134287943 16:12878913-12878935 TGTTCACTGCCAGAGAAAAAAGG + Intergenic
1134313634 16:13098512-13098534 TGTTCTCTGCAAGTGAGAAAGGG + Intronic
1135184077 16:20299707-20299729 TCTTCTCTCCAGCAGATGAAGGG + Intergenic
1135594044 16:23727842-23727864 GGTTCCCTGGGGGAGATAAAGGG - Intergenic
1137771348 16:51017839-51017861 TGTTTTCTGCAGAAGGAAAAAGG - Intergenic
1138629061 16:58279130-58279152 TGTGAGCTGCGGGAGATAAATGG + Intronic
1139985412 16:70894538-70894560 TGGTCTCTGCAGGAGCTGAAGGG - Exonic
1140801683 16:78494248-78494270 TGTTCTCTGCAGGAACTAGACGG - Intronic
1141315833 16:82961775-82961797 TGGCCTCTGCAGAGGATAAAAGG + Intronic
1142307723 16:89294905-89294927 TGTTGTCTGCAGGTAAGAAAAGG + Intronic
1142827903 17:2525647-2525669 GGTTCTCTGCAAGAGTTCAACGG + Intergenic
1144108543 17:12009036-12009058 TGTTCACTGGAGGAAATGAAGGG + Intergenic
1144364176 17:14526124-14526146 TGTTATCTGCAGGAGTAATAGGG - Intergenic
1146602718 17:34232732-34232754 TGTTATCTGCAGGAGTTACTGGG - Intergenic
1146663379 17:34680304-34680326 TGTTATCTGCAGGAGTAAATGGG - Intergenic
1146823613 17:36004245-36004267 TGTTATCTGCAGGAGAAATTGGG + Intergenic
1147053106 17:37812752-37812774 TGTTCTCTAGAGAAGATACACGG - Intergenic
1147347508 17:39811718-39811740 TGAACACTGCAGGGGATAAATGG + Intronic
1147388981 17:40097932-40097954 TATTCTCTGAAGGAAATGAAGGG + Intronic
1147562031 17:41515189-41515211 CATTCTCTGCATGAGATAGATGG - Intronic
1150030442 17:61728822-61728844 TGATATCTCCAGGAGAAAAAAGG + Intronic
1150211149 17:63442193-63442215 TGTGCTTTACAGGAGATAAGCGG + Intronic
1150516483 17:65815896-65815918 TGTCATCTACATGAGATAAAAGG - Intronic
1151224123 17:72636082-72636104 TGTTCTTTGCAAGAAAAAAATGG - Intergenic
1151436248 17:74099620-74099642 TGATCTCTGCAGGAGGGAAATGG - Intergenic
1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG + Intergenic
1154269537 18:12907233-12907255 TGTGCTCTGAAGAAGAGAAATGG + Intronic
1157038326 18:44005285-44005307 TGTTATCTGCAGGAGCAAATTGG + Intergenic
1158526142 18:58216148-58216170 TCTTCTCTGCTGATGATAAATGG - Intronic
1159179497 18:64883417-64883439 TATTTTCAGCAGGAGAGAAATGG + Intergenic
1159372440 18:67545817-67545839 GATTCTCTGCAGGATATATATGG - Intergenic
1160403037 18:78624968-78624990 TGTTCTGTGCAGGATGGAAAGGG + Intergenic
1164767616 19:30783956-30783978 TCTCCTCTGCCCGAGATAAAGGG + Intergenic
1168313778 19:55474893-55474915 TGGTCTCTGCAGTAGTGAAAGGG - Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926469967 2:13242689-13242711 TTTTCACTGCATGAGAGAAAGGG - Intergenic
926912727 2:17866146-17866168 TCTTCAAGGCAGGAGATAAAGGG + Intergenic
927027038 2:19079151-19079173 TTTGCTCTGCAGGGGAGAAAAGG - Intergenic
927251540 2:20999053-20999075 TTTTCTCTACAGGACATTAAAGG + Intergenic
927350203 2:22102938-22102960 TGTACACAGCAGGAAATAAATGG + Intergenic
928329008 2:30343136-30343158 TGGTCTCAGCAGTAAATAAACGG - Intergenic
930880389 2:56263805-56263827 TGTAAGCTGGAGGAGATAAAAGG - Intronic
932239544 2:70146059-70146081 TGTTCTCTCCAGAATACAAATGG + Intergenic
932983022 2:76693152-76693174 TGTTCTCTCCAAGAGTTAATGGG - Intergenic
933687486 2:85154749-85154771 TGTTCTCAGCACCAGATATAAGG + Intronic
934112572 2:88756871-88756893 TGGTCTCTTCAGGAGGCAAAGGG + Intergenic
935088282 2:99869597-99869619 TGTACTGGGCTGGAGATAAATGG - Intronic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
935568960 2:104638919-104638941 TGGTCTGAGCAGAAGATAAATGG + Intergenic
936163781 2:110103332-110103354 TGGTCTCTTCAGGAGGCAAAGGG + Intronic
939440786 2:142246670-142246692 TGTTCACTGATGGAGAGAAAGGG + Intergenic
939456769 2:142447041-142447063 TGTTCTCAGTAAGAGATAACAGG + Intergenic
939880918 2:147630407-147630429 TGTTCTGTGTAGTACATAAATGG + Intergenic
940361113 2:152797159-152797181 TCTTCTCTGCAGGGGATGCAGGG + Intergenic
941989989 2:171546419-171546441 TGTCATCTGCAGGTCATAAAGGG - Intronic
942194760 2:173506437-173506459 TGTTCTCAGAAGGAGAAAAATGG + Intergenic
943635367 2:190301205-190301227 TGTTCTGTATGGGAGATAAAGGG - Intronic
944372035 2:198995706-198995728 TCTTCTCTGCTGTAGCTAAAAGG + Intergenic
944649907 2:201819476-201819498 TTTACTCTGCAGGAGATGAGAGG + Intronic
945408145 2:209475961-209475983 TCTTCTCTGAAAGAGAGAAATGG - Intronic
945440154 2:209868736-209868758 TGTTCTCTGCATGGGTTACAGGG - Intronic
945770827 2:214040113-214040135 TGTTATCTGCAGGAGTAATAGGG + Intronic
946277506 2:218642546-218642568 TGGTCTCTGCAGGAGAGCCAGGG + Exonic
947557187 2:231104268-231104290 TGTTAGCTACAGGAAATAAAAGG - Intronic
1169114390 20:3054028-3054050 TGCCCTCTGCTGGAGATAAGGGG - Intergenic
1170868170 20:20179035-20179057 TATTTTCTGCAAGACATAAAGGG + Intronic
1173654966 20:44693644-44693666 TGTTTTCTGCAGGTCATATAGGG + Intergenic
1177409502 21:20711349-20711371 TGTTATCTGAAGGAGATAGTAGG - Intergenic
1177685022 21:24424685-24424707 TTATCTCTGCTGAAGATAAAAGG - Intergenic
1178991699 21:37362083-37362105 TTTTATCTGAAGGAGATAATTGG + Intergenic
1179050785 21:37887130-37887152 AGTTCTCAGCAGGGGATAACAGG - Intronic
1179250107 21:39664999-39665021 AGTTCTAGGCTGGAGATAAATGG - Exonic
1180818378 22:18807553-18807575 TGTTCTCTGCAGTTTTTAAATGG - Intergenic
1181204600 22:21242008-21242030 TGTTCTCTGCAGTTTTTAAATGG - Intergenic
1182983887 22:34698516-34698538 GGTGCTCTCCAGGAGCTAAAAGG - Intergenic
1203222324 22_KI270731v1_random:53407-53429 TGTTCTCTGCAGTTTTTAAATGG + Intergenic
1203268507 22_KI270734v1_random:33407-33429 TGTTCTCTGCAGTTTTTAAATGG - Intergenic
950547068 3:13644600-13644622 TGTTATCTGCAGTGGTTAAAAGG - Intergenic
950728708 3:14937232-14937254 TGTTTTCAGCAGCAGGTAAATGG + Intergenic
954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG + Exonic
956004153 3:64761129-64761151 TGTTCTCTGAAGGGGAAACAAGG - Intergenic
956533088 3:70243145-70243167 TCTTGTCTGCAGAAGACAAAAGG - Intergenic
956883865 3:73538709-73538731 TGTTCTATGCAGGAGAAAAATGG - Intronic
959311230 3:104740278-104740300 TGGCCTCTGGAGGAGATGAATGG + Intergenic
959363772 3:105429610-105429632 TTTTCTCTGGAGAAGATTAAAGG - Intronic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
961466443 3:127084742-127084764 TCCTCTCTGCAGGGGATAACAGG - Intergenic
962510128 3:136090634-136090656 TGATCTCTGAAGAAGACAAAAGG + Exonic
964859698 3:161187448-161187470 TATTCACTACAGGAGAAAAAAGG + Intronic
965994744 3:174867495-174867517 TGTTCTCTTCCTGAGATGAAAGG + Intronic
967540768 3:190665103-190665125 TTTGCTCTGCTGTAGATAAAAGG + Intergenic
967641677 3:191872758-191872780 TTTTCACTGAAGGAGAGAAATGG + Intergenic
967668371 3:192202058-192202080 TGTCATCTGAATGAGATAAATGG - Intronic
968321777 3:197775802-197775824 TGTTCACTGCAGAAGCAAAAAGG - Intronic
970229647 4:13896491-13896513 TGTTATCTGAAGGAGATATAAGG - Intergenic
970264621 4:14267788-14267810 TGCTCTTTGCAGAAGACAAAGGG - Intergenic
971468737 4:26995362-26995384 TATGAACTGCAGGAGATAAAAGG - Exonic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
973902619 4:55493155-55493177 TGTTCTCTGGAATAGATAACAGG - Intronic
974732939 4:65893471-65893493 TCCTCTTTGCAGGAGAGAAAAGG + Intergenic
974826781 4:67141391-67141413 TCTTGTCTGCAGGAGCAAAAAGG - Intergenic
975008824 4:69323312-69323334 TCTTTTCTGCAGAAGATAATCGG - Intronic
975199462 4:71568876-71568898 TGTTCTATGAAGGAGATTGAGGG + Exonic
976436147 4:85020698-85020720 TCTTCTCCACAGGAGATAAGAGG - Intergenic
976698283 4:87941624-87941646 TGGTTTCTGCAGAAGATAAATGG + Intergenic
979807884 4:124997281-124997303 TGGTCTGTGCAGGAGTCAAAAGG - Intergenic
979888965 4:126065593-126065615 TCTTCTCTTCAGTAGACAAAGGG - Intergenic
980572997 4:134647438-134647460 TGTTCTATACAGGTGTTAAAGGG - Intergenic
984987277 4:185343687-185343709 TGTTCACTGCTGGGGAAAAAAGG - Intronic
985083301 4:186288327-186288349 GGTTCTCTGCAGTATATTAAGGG + Intronic
986470225 5:8066500-8066522 TCTTCTCTGCATGATATGAAAGG - Intergenic
987294247 5:16536126-16536148 TGTTTTCCCAAGGAGATAAAAGG - Intronic
988029462 5:25743974-25743996 TGTTTTCTGAAGGAAACAAAAGG + Intergenic
988522991 5:31963013-31963035 TGTTCTCAGCAGGAAATAACAGG - Intronic
989204106 5:38794569-38794591 TGTTACCTGCTGGAAATAAATGG - Intergenic
989327900 5:40221618-40221640 TGGCCTTTGCTGGAGATAAATGG + Intergenic
991414221 5:66375813-66375835 TCTTGTTTGCAGAAGATAAAAGG + Intergenic
992091114 5:73317749-73317771 TGTTCACTGCATGATGTAAAAGG + Intergenic
992975041 5:82107379-82107401 GGGTGTTTGCAGGAGATAAAGGG + Intronic
994699179 5:103111823-103111845 TGGTCTCTCCAGGAGGTAAATGG - Intronic
995385670 5:111586199-111586221 GGTTCTCTGCAGCAGATTATGGG + Intergenic
997242236 5:132315815-132315837 TGTGCTCTGCAGGAAATTACTGG + Intronic
997361351 5:133297093-133297115 AGCTCTCTACAGGAGAAAAAAGG + Intronic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
1000442934 5:161284615-161284637 TGTCCTCTGCAGCAGAGATATGG + Intergenic
1002910938 6:1490539-1490561 AGCTATCTGCAGGAGATGAAAGG + Intergenic
1004104846 6:12657341-12657363 TGTGCTCTGCTGGGGTTAAATGG + Intergenic
1004249554 6:14012361-14012383 TGTTCTATGCAGGCCATCAAAGG + Intergenic
1004474537 6:15959125-15959147 TGTTATCTGCAGGAGTAATATGG + Intergenic
1004827282 6:19436778-19436800 TTTTCTCTGCATGAGATGAGAGG + Intergenic
1005215220 6:23518649-23518671 TTTTCTCTTCATGAGATGAAAGG + Intergenic
1005743822 6:28817412-28817434 TGTTCTGAGCAGGAGATACTTGG + Intergenic
1007308498 6:40926007-40926029 TGCTCTGTGAAGGAGATAGAAGG - Intergenic
1007424922 6:41740605-41740627 TGCTGGCTGCAGGAGAGAAAGGG + Exonic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1009688352 6:66992197-66992219 TGGTTTCTGCAGTAGAAAAAGGG - Intergenic
1009778905 6:68243384-68243406 TGTTCTCTCTAGGAGACAGAAGG + Intergenic
1010147906 6:72693530-72693552 TTTTCTCTGGAGGAAAAAAAGGG + Intronic
1010208411 6:73343486-73343508 TCTTGTGTGCAGGATATAAAGGG - Intergenic
1010648233 6:78420026-78420048 TGGTCTCTCCAAGAGAGAAAGGG - Intergenic
1011737980 6:90331753-90331775 AGTGCTCTGAAGGAGAGAAATGG - Intergenic
1013085051 6:106849683-106849705 TGTTCTATGGAGAAGCTAAAGGG - Intergenic
1013423057 6:109983722-109983744 AGGTCTCAGCAGGAGACAAATGG + Intergenic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1014691310 6:124566588-124566610 TTTTCTCTGCAGGATATTAATGG + Intronic
1016814484 6:148290938-148290960 TGTTTTATGAAAGAGATAAAAGG + Intronic
1017227809 6:152041120-152041142 AGTTATCTGCAGGAGATGCAGGG + Intronic
1020843039 7:13244986-13245008 TGTTGTCAACAGAAGATAAATGG - Intergenic
1021511197 7:21434276-21434298 TTTACTCTTCAGGAGATTAAGGG + Intronic
1021643251 7:22761418-22761440 TGTTCTTAGCAGGAGAAATAGGG + Intergenic
1022166642 7:27771560-27771582 TGTGCTCTCCAGGTGATAAAGGG + Intronic
1023816266 7:43952576-43952598 TGTTCTCTGCAGCACATTGAAGG + Intronic
1024286665 7:47763648-47763670 TTTTCCCTGAAGGTGATAAATGG + Intronic
1024731219 7:52255935-52255957 GGTTCTCTGCAGCAGGTGAATGG + Intergenic
1028720865 7:94029644-94029666 TGTTCTCTACAGAAGGCAAATGG - Intergenic
1031914889 7:127553805-127553827 TGTTATCTGAAGGAACTAAAAGG - Intergenic
1032739008 7:134720297-134720319 TTTCCTCTGCAGGAAATAGAAGG - Intergenic
1034082275 7:148290039-148290061 TGTTATATGCAGAATATAAAGGG + Intronic
1035283106 7:157789490-157789512 AGGTCTCTGCCGGAGAGAAAAGG + Intronic
1038000949 8:23390724-23390746 TCTTCTCTGCAGCTCATAAAGGG + Intronic
1039368551 8:36959772-36959794 TGTACTTTGCATGAGAGAAAGGG + Intergenic
1042146271 8:65733329-65733351 AGTTCTCTGCAGCACACAAAAGG - Intronic
1042463039 8:69093216-69093238 TGTTTTCTGCATGAGGTAAGTGG + Intergenic
1045169987 8:99654829-99654851 TGTTCTTGGCTGGGGATAAAAGG + Intronic
1047043439 8:121024703-121024725 TGTTCTAGGCTGGAGAGAAAAGG - Intergenic
1048006597 8:130424591-130424613 CCTTCTCAGCAGGTGATAAAAGG + Intronic
1048058274 8:130890545-130890567 TTTTCTCAGCATGAGATAAAAGG + Intronic
1048933780 8:139338751-139338773 GGTTCTCTGCAGGTGACAACAGG + Intergenic
1050308999 9:4333962-4333984 TGACCTCTGCAGGAGAGGAAAGG + Intronic
1050673853 9:8029180-8029202 TGTTCTGGTCAGGAGATGAATGG - Intergenic
1051602662 9:18890393-18890415 TGTCCTCAGCAGTAGTTAAATGG + Intronic
1052486496 9:29107477-29107499 TGTTTTCTCCAGAATATAAAAGG + Intergenic
1053279836 9:36812860-36812882 TCTTCTCTGGATGAGACAAAGGG + Intergenic
1056878930 9:90369635-90369657 TGTTCTCTCCAGGAGAGCAATGG + Intergenic
1057795875 9:98157655-98157677 TGACATCTGCAGGAGACAAATGG + Exonic
1057917177 9:99065744-99065766 TGTCCTCTGCAGGAAGGAAAGGG + Intronic
1057948984 9:99354652-99354674 TAATCTCTGCAGGAATTAAATGG - Intergenic
1060995470 9:127873056-127873078 GCTTCTCTGCGGGAGAGAAAAGG + Exonic
1061032051 9:128091084-128091106 TGTGCTCTGCTGGAGAAAACTGG + Intronic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1186815862 X:13237448-13237470 TTATCTCTGCAAGAGAGAAAGGG + Intergenic
1189222234 X:39382404-39382426 TGGTCTGGCCAGGAGATAAAAGG + Intergenic
1189634004 X:42985663-42985685 TGAGCTCTGCAGGAGGTAATGGG + Intergenic
1190601621 X:52098722-52098744 TGAACTCTGCAGAAAATAAATGG - Intergenic
1190797293 X:53757684-53757706 TCTTCTCTGCAGCATATAATTGG + Intergenic
1195707380 X:107747804-107747826 TGTTCTGTGCTGGAGATCAGAGG - Intronic
1197620547 X:128742955-128742977 TCTTCCCTGTAGGAGATAAGAGG - Intergenic
1198434632 X:136604568-136604590 TGTTTTTTTGAGGAGATAAATGG - Intergenic
1198844109 X:140891100-140891122 TCTTTTCTGTAGGAGATGAAAGG - Intergenic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic