ID: 954705171

View in Genome Browser
Species Human (GRCh38)
Location 3:52476387-52476409
Sequence TCCCAGTGAGTGTTGCGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954705165_954705171 28 Left 954705165 3:52476336-52476358 CCACATGCTAAATATGCTCCAGC 0: 1
1: 0
2: 0
3: 11
4: 134
Right 954705171 3:52476387-52476409 TCCCAGTGAGTGTTGCGTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
954705167_954705171 6 Left 954705167 3:52476358-52476380 CCCTTCCTTAAATTCTGCAACGA 0: 1
1: 0
2: 1
3: 7
4: 135
Right 954705171 3:52476387-52476409 TCCCAGTGAGTGTTGCGTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
954705169_954705171 1 Left 954705169 3:52476363-52476385 CCTTAAATTCTGCAACGACTGTG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 954705171 3:52476387-52476409 TCCCAGTGAGTGTTGCGTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
954705168_954705171 5 Left 954705168 3:52476359-52476381 CCTTCCTTAAATTCTGCAACGAC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 954705171 3:52476387-52476409 TCCCAGTGAGTGTTGCGTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
954705166_954705171 10 Left 954705166 3:52476354-52476376 CCAGCCCTTCCTTAAATTCTGCA 0: 1
1: 1
2: 3
3: 25
4: 246
Right 954705171 3:52476387-52476409 TCCCAGTGAGTGTTGCGTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954705171 Original CRISPR TCCCAGTGAGTGTTGCGTGA GGG Intronic
905348551 1:37328396-37328418 ACCCAGTCAGTGTTTGGTGAAGG + Intergenic
907107694 1:51899163-51899185 TCTGAGTGAGTGTGGCGTGTGGG - Intergenic
908422077 1:63968927-63968949 TCCCACTAAGTGTTTTGTGATGG + Intronic
910468146 1:87522642-87522664 TTCCAGTGAGGGTTACGTAAGGG + Intergenic
912382418 1:109254661-109254683 CCCCAGGGAGTGTGGCCTGAAGG + Intronic
913576478 1:120180433-120180455 TCACAGTGCGAGCTGCGTGAAGG + Intergenic
914558384 1:148791871-148791893 TCACAGTGCGAGCTGCGTGAAGG + Intergenic
914614451 1:149338359-149338381 TCACAGTGCGAGCTGCGTGAAGG - Intergenic
915978199 1:160404279-160404301 GCCCAGTGAGTGCTGTGTGGAGG + Intronic
921262355 1:213395328-213395350 TCTCAAAGAGTGTTGGGTGAAGG + Intergenic
922983069 1:229844843-229844865 TCCCAGTGAGTCTGGTGAGATGG - Intergenic
1066066530 10:31765212-31765234 CCCCAGTGAGTGTTCCCTGTGGG + Intergenic
1071149162 10:82613151-82613173 TCCCAGTTAGTCTTGGGAGATGG + Intronic
1072575247 10:96693593-96693615 TCCAAGAAAGTGTTACGTGAAGG - Intronic
1073379895 10:103070134-103070156 TCACAGTGGGTGTTGGGTGTTGG - Intronic
1074498598 10:114002096-114002118 TCCCAGTCAGTGGTGCCTTAAGG - Intergenic
1075242755 10:120793144-120793166 GTCCAGTGTGTGTTGTGTGAGGG - Intergenic
1075279936 10:121130488-121130510 TACCAGTGACTGATGCGTGTTGG - Intergenic
1075377766 10:121993015-121993037 TCCCAGAGAGTTTTGAATGAGGG - Intronic
1077088037 11:764429-764451 TGACAGTGAGTGTTGTGTGTGGG + Exonic
1080441153 11:32295872-32295894 TCCCACTGATTGTTGCAGGATGG - Intergenic
1082700101 11:56418295-56418317 TCCCTGTCAGTGTTGGGTAAAGG + Intergenic
1084229294 11:67739318-67739340 TTCAAGTGAGTGTTGAGGGACGG - Intergenic
1085347806 11:75779510-75779532 TCCCAGAGAGTGCTGTGGGACGG + Intronic
1085571510 11:77561929-77561951 TCACAGAGAGTGTAGAGTGATGG - Intronic
1089931861 11:122320857-122320879 TGCCAGTGACTGCTGCGTGGGGG - Intergenic
1090664286 11:128904729-128904751 ACCCAGTGGGTGTTGAGTGGGGG + Intronic
1097484859 12:60183579-60183601 TCCCAGTGAGTGATGCCATAGGG + Intergenic
1103409280 12:120699281-120699303 TGCCAGTGAGGGGTGCGTGGAGG + Exonic
1115191702 14:30753601-30753623 TCCTAGTGTCTGTTGCCTGATGG - Intergenic
1118464717 14:66020537-66020559 TCCCAGTGGGTGTAGCATGTAGG - Intergenic
1118785177 14:69039715-69039737 TGCCAGTCAGTGTTGGGTGCTGG - Intergenic
1119054839 14:71408682-71408704 TCCCAGAGAGTTTTGAGTAAAGG - Intronic
1120134312 14:80847967-80847989 GCCCAGTAAGTGTTTCTTGAAGG - Intronic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1122196702 14:100092934-100092956 TACAAGTGAGTGTTGGGTGATGG + Intronic
1122594361 14:102879011-102879033 GCCCAGTGAGTGGAGGGTGATGG + Intronic
1122921671 14:104882870-104882892 TCCCAGAGGGTGGTGTGTGAAGG + Intronic
1123163678 14:106305002-106305024 TCCCAGTGAGCCTTGTGTGTAGG - Intergenic
1123774736 15:23566898-23566920 TCCCAGTGAGTTCTGGGTGGAGG + Exonic
1124249535 15:28097759-28097781 TCCCAGTTGGTGATGGGTGATGG - Intronic
1125013002 15:34900476-34900498 TCCCAGTGATTGTATGGTGAAGG + Intronic
1126714830 15:51503969-51503991 TCCCTGTCAGTCTTGCATGATGG - Intronic
1131008193 15:88995713-88995735 ACCCAGTGAGTATTGGGTAATGG - Intergenic
1138185035 16:54970345-54970367 TCACAGTGAGTGATGGGTGCTGG + Intergenic
1138239678 16:55417308-55417330 TGGCAGTGTGTGTTGGGTGATGG + Intronic
1142929225 17:3268292-3268314 TCCCAGTGATTGCTGCCTCATGG + Intergenic
1144114513 17:12074314-12074336 TCCCAGAGATTATTGTGTGATGG + Intronic
1146927197 17:36753309-36753331 TCCCAGTGAGTGTGTGGTGTGGG + Intergenic
1150413767 17:64970025-64970047 CCTCAGTCAGTGCTGCGTGAGGG - Intergenic
1150797870 17:68253647-68253669 CCTCAGTCAGTGCTGCGTGAGGG + Intronic
1152175383 17:78783319-78783341 TCTCAGTGAGTGTTCTGTGTAGG - Intergenic
1155329049 18:24696091-24696113 TACCAGTGAGTGCTATGTGATGG + Intergenic
1155426514 18:25713054-25713076 TCCCAGTGAGTGTCTGGTGCAGG - Intergenic
1164914433 19:32039686-32039708 TCTCATTGCGTGATGCGTGAAGG - Intergenic
1165636891 19:37347868-37347890 TCCAGGTGAGTGTTGAGTGTGGG + Exonic
1166090075 19:40503088-40503110 TCCAAGTGATTGTTGGGTGAGGG + Intronic
1167881786 19:52465273-52465295 ACCCAGTGAGTGGTGGGGGAGGG - Intronic
931178609 2:59877566-59877588 TCCTAGTGAGTCTTGTGAGATGG - Intergenic
934738892 2:96704943-96704965 TCCCTGTGAGTCTTGTCTGAAGG - Intergenic
935782377 2:106519499-106519521 TTCCAGTGAATGTGGCCTGATGG + Intergenic
1168981447 20:2007362-2007384 TCCCAGTCAGGGTTGTGAGAAGG - Intergenic
1170408407 20:16063557-16063579 TCCATGTCAGTGTTGCATGAGGG + Intergenic
1177986845 21:27986795-27986817 TCCCAGTGACTTATGAGTGAAGG + Intergenic
1180966596 22:19791625-19791647 TCCCTATGAGTCTTGTGTGAGGG + Intronic
1181322372 22:22018130-22018152 TACCAGTGACTGATGGGTGAGGG - Intergenic
1182132539 22:27867293-27867315 TCCCAGTGTGTCTTGGGTCAGGG - Intronic
1182772106 22:32803283-32803305 TTCCACTGAGTCTTGGGTGAGGG + Intronic
1183295658 22:37027885-37027907 CCCCAGCCAGTGTGGCGTGAAGG + Intronic
1185189202 22:49423441-49423463 CCCCATTGTGTGTTGGGTGAAGG + Intronic
951590189 3:24256119-24256141 TCCCAGAGAGTTTTGTGTCATGG + Intronic
954705171 3:52476387-52476409 TCCCAGTGAGTGTTGCGTGAGGG + Intronic
955596755 3:60599396-60599418 TACCAGTGAGTTTTGCATGAAGG + Intronic
957513197 3:81216204-81216226 GCACAGTGAGTGCTGCGTGCTGG - Intergenic
963836549 3:150063413-150063435 TCCCAGTGAGACCTGCCTGATGG + Intergenic
964642178 3:158920557-158920579 ACTCAGTGAGTGTTCTGTGAGGG - Intergenic
966850857 3:184164384-184164406 TTCCAGTGAGTGTGACCTGAGGG + Exonic
968990148 4:3905302-3905324 TTCAAGTGAGTGTTGAGGGACGG - Intergenic
969569537 4:8000559-8000581 CCCCAGAGAGTGCTGCCTGAGGG - Intronic
979183019 4:117754423-117754445 TCCCTGTCAGTGTTGCTGGATGG + Intergenic
982104392 4:151998987-151999009 GCCCAGTTAGTGCTGCGTAACGG + Intergenic
989413009 5:41141531-41141553 TCCCAGTGAGTTTTGCTGGAAGG + Intergenic
995555683 5:113325968-113325990 TGCCAGTGAGTGTGGAGTAAGGG + Intronic
996746278 5:126848814-126848836 TCCCAGTGAATGGTTGGTGAAGG - Intergenic
1000430989 5:161152320-161152342 TCCCAATGAGAGTGGTGTGATGG - Intergenic
1000674616 5:164105589-164105611 TCCCAGTGGGGGTTGTGTGTGGG - Intergenic
1002660102 5:180785969-180785991 TTCCAGTGAGTGGAACGTGAGGG + Intergenic
1003016200 6:2469361-2469383 TCCCAGTGGGTGCTGCGGGGAGG + Intergenic
1006845924 6:37061583-37061605 TGCCAGTGAGTGTCACGTGGGGG + Intergenic
1007413087 6:41676035-41676057 CCCCAGTGAGTGTTGTGATAAGG - Intergenic
1015581413 6:134729467-134729489 GCACAGTGAGTGTTGAGTAAGGG - Intergenic
1020310034 7:6860216-6860238 TTCAAGTGAGTGTTGAGGGACGG - Intergenic
1020312971 7:6883356-6883378 TTCAAGTGAGTGTTGAGGGACGG - Intergenic
1021086707 7:16429207-16429229 TCCCAGTGAGTGTCCCATGCTGG - Intergenic
1023377239 7:39569397-39569419 ACCCAGAGAGTGTTGTGTTATGG + Intronic
1031994383 7:128219763-128219785 TCCCAGCAAGTCTTGCCTGATGG + Intergenic
1032192784 7:129774100-129774122 TACCAGTGTGTGGTGTGTGAAGG + Intergenic
1035313609 7:157984558-157984580 GCCCTGTGAGTGGTGAGTGATGG + Intronic
1037138419 8:15491317-15491339 TCCCTGTGAGTAATACGTGAGGG + Intronic
1038317573 8:26500886-26500908 CCACAGTGAGTGTTGGGGGAAGG + Intronic
1043880326 8:85535189-85535211 TCCCAGGGAGGGCTGCGAGAGGG + Intergenic
1046389472 8:113550741-113550763 TCCCAGAGAGTTCTGAGTGAAGG - Intergenic
1047349784 8:124062724-124062746 TCCCTGTGTGTGTTCCCTGAGGG + Intronic
1047361054 8:124169797-124169819 TCCCAGTGAGGCTTGTGTCAGGG + Intergenic
1058198086 9:102003355-102003377 TACCAGTGTGTGTTGGGGGAGGG - Intergenic
1060159692 9:121349934-121349956 TCCCAGTGAGTTTTAAGTGATGG - Intronic
1060281456 9:122218507-122218529 TGACAGTGAGGGTTGCATGATGG - Intronic
1061845489 9:133385830-133385852 CCCCAGTGAGTGTTAGGTCAGGG - Intronic
1186271823 X:7896766-7896788 TCCAGGTGAGTGGTGGGTGAGGG + Intergenic
1198428966 X:136546923-136546945 TCACAGTGAGTGATGGGGGATGG - Intronic